Skip to main content

Full text of "Molecular phylogeny and taxonomic revision of the woolly lemurs, genus Avahi (Primates : Lemuriformes)"

See other formats


la 


1 


W 




TEXAS TECH UNIVERSITY 


Natural Science Research Laboratory 


Special Publications 

Museum of Texas Tech University 

Number 51 20 June 2007 


Molecular Phylogeny and Taxonomic Revision 
of the Woolly Lemurs, Genus Avahi 
(Primates: Lemuriformes) 




J/KM# Hit 



r i yi'iW h»il 


1 .■ r- 


S 


UiJirniri'u 


fji 

^ ,1m ;-r i rJr.'UJJ t)ffw *- 
C ^vjin rjM&aunt NWTpnd 
(i .ItwJh' I'jvriii^r 

Uli'twlnr 
-trnfri Ffftxt r 
■^1 ri illSj 1XCVI Ji'Ajili'l I 


Rambinintsoa Andriantompohavana, etal. 














Front cover: Revised distribution of the woolly lemurs of Madagascar. The revisions of the sportive lemurs 
(Louis et al. 2006b) and this publication demonstrate the partitioning of unique Avahi and Lepilemur species by 
rivers which act as barriers. Each region is defined by a distinct woolly and sportive lemur. Figure created by 
Kelly Herrington and Edward E. Louis, Jr. 



Special Publications 

Museum of Texas Tech University 

Number 51 


Molecular Phylogeny and Taxonomic Revision 
of the Woolly Lemurs, Genus Avahi 
(Primates: Lemuriformes) 


Rambinintsoa Andriantompohavana, Runhua Lei, JohnR. Zaonarivelo, 
Shannon E. Engberg, Gerard Nalanirina, Susie M. McGuire, 
GaryD. Shore, Justin Andrianasolo, Kelly Herrington, 

Rick A. Brenneman, and Edward E. Louis, Jr. 


University of Antananarivo and Henry Doorly Zoo 



Layout and Design: Jacqueline Chavez 

Cover Design: Kelly Herrington and Edward E. Louis, Jr. 

Copyright 2007, Museum of Texas Tech University 

All rights reserved. No portion of this book may be reproduced in any form or by any means, 
including electronic storage and retrieval systems, except by explicit, prior written permission 
of the publisher. 

This book was set in Times New Roman and printed on acid-free paper that meets the guidelines 
for permanence and durability of the Committee on Production Guidelines for Book Longevity of 
the Council on Library Resources. 

Printed: 20 June 2007 


Library of Congress Cataloging-in-Publication Data 

Special Publications of the Museum of Texas Tech University, Number 51 
Series Editor: Robert J. Baker 


Molecular Phylogeny and Taxonomic Revision of the Woolly Lemurs, Genus Avahi (Primates: Lemuriformes) 

Rambinintsoa Andriantompohavana, Runhua Lei, John R Zaonarivelo, Shannon E. Engberg, 

Gerard Nalanirina, Susie M. McGuire, Gary D. Shore, Justin Andrianasolo, Kelly Herrington, 

Rick A Brenneman, and Edward E. Louis, Jr 


ISSN 0169-0237 
ISBN 978-1-929330-12-6 


Museum of Texas Tech University 
Lubbock, TX 79409-3191 USA 
(806)742-2442 




Molecular Phylogeny and Taxonomic Revision of the Woolly Lemurs, 

Genus Avahi (Primates: Lemuriformes) 


RambinintsoaAndriantompohavana, RunhuaLei, John R. Zaonarivelo, Shannon E. Engberg, 
Gerard Nalanirina, Susie M. McGuire, Gary D. Shore, Justin Andrianasolo, 

Kelly Herrington, Rick A. Brenneman, and Edward E. Louis, Jr. 

Abstract 

Approximately 3,000 base pairs of mitochondrial DNA sequence data (control region or 
D-loop, along with a fragment including a partial segment of cytochrome oxidase subunit 111 gene 
to Leucine-tRNA gene), morphological and phenotypic characters were used to investigate the 
phylogenetic relationships among the recognized woolly lemurs (genus Avahi) and to other lemur 
genera of Madagascar. The molecular data support the previously recognized Avahi species, but 
it has also revealed additional unique biodiversity. Here, we present further taxonomic revisions 
of the genus Avahi , by elevating the two recently described subspecies, A. m. meridionalis and 
A. m. ramanantsoavana , to species level, along with a description of one new species. We also 
conducted the first phylogenetic analysis of all recognized species of woolly lemurs, all repre¬ 
sentatives of the family Indriidae, and present the relationships between the recognized species 
of the genus Avahi and this newly described species. These results underscore the urgency to 
initiate further detailed studies in previously unstudied sites throughout Madagascar in order to 
better define lemur species. 

Key words: Avahi , D-loop, Madagascar, prosimian, systematic, woolly lemurs 


Introduction 


Due to its unique species biodiversity and the con¬ 
tinued pressure from human encroachment in the form 
of habitat destruction and fauna and flora utilization, 
Madagascar has been placed at the top of conservation 
priority lists, or hotspots (Myers 2000). Distributed 
throughout the island, the prosimians of Madagascar 
are particularly susceptible to extinction risks due to 
their relatively small, fragmented geographic ranges, 
and the potential loss through edge effects and constant 
habitat loss (Jernvall and Wright 1998; Reed 2004; 
Ezard and Travis 2006). Since 2000, multiple molecu¬ 
lar genetic and morphological studies w ithin the genera 
Avahi , Cheirogaleus, Lepilemur, Microcebus , and Mina 
have led to a significant increase in the number of 
recognized species (Zimmermann et al. 1998; Groves 
2000; Rasoloarison et al. 2000; Kappeler et al. 2005; 
Thalmann and Geissmann 2005; Andriaholinirina et 
al. 2006; Andriantompohavana et al. 2006; Louis et 
al. 2006a, 2006b; Zaramody et al. 2006). With the 


addition of newly described species, the once broad 
ranges of the previously recognized nocturnal species 
have dramatically decreased and concurrently made 
the risk of extinction of both recognized and newly 
described lemurs much greater (a smaller distribution 
and a diminished number of represented subpopula¬ 
tions). Currently, all lemurs are protected under the 
Convention of International Trade of Endangered Spe¬ 
cies (CITES) and are designated by the 1UCN/SSC Red 
List Categories from critically endangered to threatened 
(IUCN 2004), Recent revisions underscore the need to 
resolve the taxonomy and phylogeny of lemurs so that 
a scientifically rational approach to their conservation 
and management can be developed and implemented. 
Furthermore, the numerous taxonomic revisions of 
lemurs have led to subsequent modifications of histori¬ 
cal distributions and population estimates that require 
a persistent re-evaluation of conservation protection 
status (Martin 2000; Louis et al. 2006b). 


1 



2 


Special Publications, Museum of Texas Tech University 


The woolly lemurs (genus Avahi), a group of 
strictly nocturnal primates that are regarded as pheno- 
typically indistinct with varying degrees of brown, red, 
white, and gray pelage, are a prime example of species 
whose taxonomic/evolutionary diversity until now has 
been largely unrecognized and underrepresented. Tra¬ 
ditionally, two species of Avahi have been recognized, 
one from eastern Madagascar, Avahi laniger , and one 
from western Madagascar, Avahi occidentalis (Fig. 
1). Initially, both species were considered subspecies 
of Avahi laniger , but morphological, molecular, and 
cytogenetic differences between the eastern woolly 
lemur, Avahi laniger , and the western woolly lemur, 
Avahi occidentalis , have conclusively established spe¬ 
cies level variance (Rumpler et al. 1990; Thalmann and 
Geissmann 2000; Zaramody et al. 2006; Figs. 2-4). 

The potential for additional species within the 
genus Avahi was predictable, given the discrete and 
often fragmented distributions, the scattered or spotty 
occurrence within these fragments, and the widespread 
area that the genus Avahi is found especially on the 
eastern coast of Madagascar ( Martin 2000; Thalmann 
and Geissmann 2000). A comprehensive study to 
define these populations is critical above and beyond 
the threat of habitat loss because the highly foli- 
vorous dietaiy requirements of the woolly lemur can 
bring about a selective liability that can potentially 
limit habitat suitability. Consequently, Thalmann and 
Geissmann (2000, 2005) based on morphological and 
vocalization data described two additional woolly 
lemurs from western Madagascar, A. unicolor and A. 
cleesei , from the Ampasindava region and Tsingy de 
Bemaraha, respectively (Figs, 1, 5-7). Furthermore, 
Zaramody et al. (2006) described two new species 
from the southeastern coast, A. peyrierasi (south of 
the Mangoro/Onive Rivers to Ranomafana National 
Park) and A. meridionalis (Manombo Special Reserve 


to Andohahela National Park; Fig. 1). Avahi meridi¬ 
onalis was further subdivided into two subspecies, A m. 
meridionalis and A. m. ramanantsoavana , from Sainte 
Luce/Andohahela National Park and Manombo Special 
Reserve, respectively (Fig. 1). Here, we present further 
taxonomic revisions of the genus Avahi , along with a 
description of one new species. We also conducted 
the first phylogenetic analysis of all recognized spe¬ 
cies of woolly lemurs, all representatives of the family 
Indriidae, and present the relationships between the 
recognized species of the genus Avahi and this newly 
described species. 

As previously discussed in Andriantompohavana 
et al. (2006), Louis et al. (2006a, 2006b), and Thalmann 
and Geissmann (2005), the utilization of whole vouch¬ 
ers as the designated holotvpe for a new species is not 
a prerequisite, but that opportunistic collections can 
later supplement morphological, vocalization, and/or 
molecular data in combination with curated blood 
and/or tissue samples. The woolly lemurs are a prime 
candidate for this methodology because the highly foli- 
vorous dietary requirements of this group of lemurs cur¬ 
rently precludes any attempts to curate Hive vouchers” 
(Thalmann and Geissmann 2005). Total genomic DNA 
for the three paratype specimens are currently curated 
at the Museum of Texas Tech University' (TK125757; 
TK125758; TK 125759). Additionally, an electronic 
database that includes all Avahi field data and photo¬ 
graphs, including data for the paratype specimens, is 
curated at the Museum of Texas Tech University. The 
database is stored in the Type Specimen Collection in 
multiple media formats. This collection of field data 
and photographs, as well as additional tables and fig¬ 
ures, also are available online at the website of Omaha’s 
Henry Doorly Zoo. See Appendix I for a directory of 
appropriate website addresses. 


(text continued on page 10) 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


3 



Bcmarivo 


Mahajamha 

Mariarano^ 

Betsibolm— 


Mangoky 


Mahavavy Nord- 

Antafondro- 

Sarnbirano- 


(MOO 

kin 


Macvarano 
Sofia 


Mahavavy Slid 

Maningoza 

Manambaho 
Mknambolo 

Tsingy de 
Bemaraha 

Tsiribihina 
Morondava 


Fiheruniina 

Onilahy 


I radii 


A ntainambalaria 

Mananara-Nord 


Maniri|'ory 

Onibe 


Mantadia 
Maroon izaha 

Maitgoro 

Fandriana 

Namorona 

Ranomafana 

Faraony 


Lima 


Andohahcla 

(Manangotry) 


Maitdrari: 


A Viihi pcyritrasi 

P Avahi nr , ramanQntsoavana 
(P Avahi m. meridionals 
P Avahi faniger 

M a no m bo Avahi ittt,caifir 

Avahi f/rrjn" 

Avahi oaidvrita fin 

(P Ftnii l'ijLut of site denotes 
wesi ccwlki Avahi species, 
all ftumeriy Avahi ttoritfettialix 
O' lmii color ol" site denotes 
cast coast Avahi species, 
iiLIl formerly Avahi laniger 


Matiampatrana 


Figure 1. Sample distribution map of the woolly lemurs of Madagascar. 
















4 


Special Publications, Museum of Texas Tech University 



Figure 2. Avahi occidentalism western woolly lemur, at Mariarano Classified Forest. Photo by Edward E. 
Louis, Jr. 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


5 



Figure 3. Avahi occidentalism western woolly lemur, at Mariarano Classified Forest. Photo by Edward E. 
Louis, Jr. 



6 


Special Publications, Museum of Texas Tech University 



Figure 4. Avahi laniger, western woolly lemur, at Mananara-Nord National Park (Ivontaka-Sud). Photo by 
Edward E. Louis, Jr. 









Andriantompohavana et al.— Woolly Lemurs of Madagascar 


7 



Figure 5. Avahi unicolor , Sambirano woolly lemur, at Antofondro Classified Forest (Maromiandra). Photo by 
Edward E. Louis, Jr. 











$ 


Special Publications, Museum of Texas Tech University 



Figure 6. Avahi unicolor , Sambirano woolly lemur, at Antofondro Classified Forest (Maromiandra). Photo 
by Rambinintsoa Andriantompohavana. 


Andriantompohavana et al.— Woolly Lemurs of Madagascar 


9 



Figure 7. Avahi cleesei, Cleese’s woolly lemur, at Tsingy de Bemaraha National Park. Reprinted with permission of the 
author and journal (Thalmann and Geissmann 2006). Photo by Urs Thalmann. 


















10 


Special Publications, Museum of Texas Tech University 


Methods 


Sampling .—All lemurs investigated in this study 
were wild-caught (sampling localities are depicted in 
Fig. 1) and were immobilized with a C0 2 projection 
rifle or blowgun with 10 mg/kg of Telazol (Fort Dodge 
Animal Health; Overland Park, Kansas). Four 2.0 mm 
biopsies and 1.0 cc per kilogram of whole blood were 
collected from each sedated animal and immediately 
stored in a room temperature storage buffer (Longmire 
et al. 1992). The location of the immobilized lemur 
was recorded using a global positioning system (Ap¬ 
pendix la). Genomic DNA was extracted from a 2.0 
mm ear punch using a phenol-chloroform extraction 
(Sambrook et al. 1989; Appendix IF). Beginning in 
2000, while the animal was sedated, we placed a 
HomeAgain microchip (Schering-Plough Veterinary 
Corp.; Kenilworth, New Jersey) subcutaneously be¬ 
tween the scapulae of each lemur (Appendix II). This 
procedure was used to field catalog each animal with 
a unique recognition code to provide for the capabil¬ 
ity to positively re-identify all captured individuals 
during any future immobilizations. Measurements 
were taken on the sedated animals as follows, weight 
(+/- 0.01 kilograms); head crown ((total length from 
tip of the nose (not the soft tissue) to the occipital 
crown)+/-0.1 cm); body length ((total length of body 
from the occipital crown of the head to the base of 
tail) +/-0.1 cm); tail length ((total length from base of 
tail to the end of the last caudal vertebra ) +/-0.1 cm); 
forelimb measurements (thumb (total length of the 
thumb (proximal, middle, and distal phalanges) from 
the distal tip to proximal point of the last bone of the 
thumb (claw not included) +/-0.1 cm), longest digit 
(total length of the phalange only (proximal, middle, 
and distal phalanx, claw and metacarpal not included) 
+/-0.1 cm), and hand (total length of hand (phalanges 
and metacarpals included to the carpal joint) +/-0.1 
cm)); radius/ulna ((carpal joint (styloid process of the 
radius) to the olecarnon tip of the ulna) +/-0.1 cm); 
humerus ((greater tubercle of humerus to the end of the 
lateral condyle of the humerus) +/-0.1 cm); hindlimb 
measurements ((toe (total length of the toe (proximal, 
middle, and distal phalanges not including claw) from 
tip to insertion point of the last bone of the hind toe 
(1st digit) +/-0.1 cm), longest digit (total length of 
the phalange only (claw and metatarsal not included) 
+/-0.1 cm), foot (total length of hand (phalanges and 
metacarpals included to the tarsal joint, not including 


claw) +/-0.1 cm), tibia ((calcaneal tuber to the proxi¬ 
mal tibial tuberosity) +/-0.1 cm), and femur ((greater 
trochanter of the femur to the distal point of the lateral 
condyle of the femur) +/-0.1 cm)); testes ((width and 
length of the right and left testes in males) +/-0.1 mm); 
and upper and lower canines ((length of the upper and 
lower right canines from the tip to the gum line) +/-0.1 
mm), For presentation purposes, we present average 
measurements and standard deviations of the weight, 
head crown, body length, tail length, forelimb, and 
hindlimb in this publication following the guidelines 
of Smith and Jungers (1997; Table 1A-B ). All other 
measurements, e-voucher photographs, and data are 
available at http://www.omahazoo.com/ccr/index. 
asp?page=/ccr/genetics/genhome.htm (Appendix la). 
All traits were tested for significance among species 
using Analysis of Variance (ANOVA) performed using 
an online statistical service (Kirkman 1996). Species 
means were plotted in histogram form with the appro¬ 
priate 95% confidence intervals (Appendix Id). 

Data Collection .—To correlate our data with 
previously published molecular studies, we analyzed 
the following regions of the mitochondrial DNA 
(mtDNA): the displacement loop or control region 
(D-loop; Baker et al. 1993; Wyner et al. 1999) and a 
fragment of the cytochrome oxidase subunit TIT gene 
(COIII), NADH-dehydrogenase subunits 3, 4L, and 
4 (ND3, ND4L, and ND4), as well as the tRNA Gly , 
tRNA Arg , tRNA His , tRNA Ser , and partial tRNA Leu genes 
(subsequently referred to as the PAST fragment; 
Pastorini et al, 2000, 2003). Using 50 nanograms of 
genomic DNA, the D-loop (562-563 base pairs (bp)) 
and the PAST (2380 bp) fragments were amplified 
using the following conditions: 94° C for 30 sec, 47° 
C for 45 sec, 72° C for 45 sec for 34 cycles. Since 
potential nuclear insertions or mitochondrial pseu¬ 
dogenes within the nuclear genome can be amplified 
inadvertently, we chose to minimize this likelihood 
by amplifying both mitochondrial DNA regions as 
intersecting or overlapping segments (Zhang and 
Hewitt 1996). Consequently, the PAST fragment was 
generated from six amplified segments. Additionally, 
to further eliminate amplification of nuclear inser¬ 
tions, a technique that is species independent and 
both rapid and efficient derived from the degenerate 
oligonucleotide-primed PCR method (DOP-PCR; 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


11 


Telenius et al. 1992) was used to generate the PCR 
products. Adapting this LL-DOP-PCR (long products 
from low quantity), the sequence data were generated 
for the D-loop fragments and PAST sequence gener¬ 
ated from overlapping segments were confirmed. The 
samples were electrophoresed on a 1.2% agarose gel to 
verify the PCR product and purified using QIAquick 
PCR purification kit (Qiagen; Valencia, California). 
Using the BigDye terminator cycle sequencing ready 
reaction kit by Applied Biosystems the sequence 
was analyzed by capillary electrophoresis with an 
Applied Biosystems Prizm 3100 genetic analyzer 
(Applied Biosystems. Inc.; Foster City, California). 
A suite of internal sequencing primers from Pastorini 
et al. (2000, 2001) were used to generate the PAST 
fragment. Additionally, PCR and sequencing prim¬ 
ers specific for genus Avahi were designed for the 
D-Loop fragment, and PCR and sequencing primers 
specific for ND4 region were utilized for the PAST 
fragments (Arevalo et al. 1994; Appendix lb). The 
sequence fragments were aligned to generate a con¬ 
sensus sequence using Sequencher (Gene Corp; Ann 
Arbor, Michigan), and the consensus sequences were 
aligned using ClustalX (Thompson et al, 1997). All 
aligned sequences are available from the first author 
upon request. All sequences have been deposited 
in GenBank and the sequence data and information 
are available from the referenced accession numbers 
(Appendix II). 

Phylogenetic Analysis. —Maximum-parsimony 
analyses (MP) were performed for the phylogenetic 
study of the D-loop, PAST, and combined (D-Loop 
and PAST fragments) sequence data with PAUP Ver¬ 
sion 4.0b 10 software (Swofford 2001). Heuristic 
searches were completed using the random addition 
sequence (1000 replicates) with the tree bisection- 
reconnection branch swapping routine. Gaps were 
considered as a fifth character in MP analyses, but 
were treated as missing data in the NJ analyses. Boot¬ 
strap analyses were accomplished with 1000, 3000, 
and 4000 pseudoreplicates with the D-loop, PAST, 
and combined data sets, respectively. Only nodes 
with greater than 50% support were reported. The 
maximum likelihood (ML) analyses were performed 
using the program PA LIP Version 4.0b 10 software 
(SwofTord 2001). Due to the large number of taxa and 


characters and the resulting computational intensity, 
we pruned the combined sequence dataset by choos¬ 
ing taxa representing distinct haplotypes supported 
in an initial neighbor-joining (NJ; Saitou and Nei 
1987) analysis. 

Bayesians inference analyses were conducted 
using MrBayes 3.0b4 (Huelsenbeck and Ronquist 
2001; Ronquist and Huelsenbeck 2003). The model 
of evolution was selected by using MrModeltest 2.2, a 
modified version of Modeltest 3.6 (Posada and Cran¬ 
dall 1998; Nylander 2004). A Markov Chain Monte 
Carlo (MCMC) run with four simultaneous chains 
and 1,000,000 generations was performed. Every 
hundredth generation, the tree with the best likelihood 
score was saved, resulting in 4000 trees. The 4000 
trees were condensed in a majority rule consensus 
tree using PAUP Version 4.0b 10 software (Swofford 
2001). Branch supports were assigned as posterior 
probabilities on the consensus tree. The pattern of 
sequence evolution was estimated by conducting a 
minimum spanning network generated with the pro¬ 
gram NETWORK Version 4.11 (Gonzales et al. 1998; 
Bandelt et al. 1999; Forster et al. 2001) and Arlequin, 
Version 2.0 (Schneider et al. 2000). 

In addition to character-based phylogenetic 
analysis of DNA sequences, PAUP software (Swof¬ 
ford 2001) was also used to calculate uncorrected 
pairwise distances for D-Loop, and PAST combined 
fragments (‘p’)- As described in Davis and Nixon 
(1992), Wyner et al. (1999), Mayor et al. (2004), 
Andriantompohavana et al. (2006), and Louis et al. 
(2006a, 2006b) we utilized MacClade 3.01 (Maddison 
and Maddison 1992) and MEGA Version 2.0 (Kumar 
et al. 1993) in a diagnostic search to designate evo¬ 
lutionary significant units (ESU) using population 
aggregate analysis (PAA) of the D-loop (562-563 bp) 
and PAST (2380 bp) sequence data for Avahi. With 
the sequential addition of each individual without 
an a priori species designation, a PAA distinguishes 
attributes or apomorphic characters according to the 
smallest definable unit (Davis and Nixon 1992; Mayor 
et al. 2004; Andriantompohavana et al. 2006; Louis 
et al. 2006a, 2006b). 



12 


Special Publications, Museum of Texas Tech University 


Results 


Following ANOVA among the species, sub¬ 
species and two additional types, only the tail length 
was found to be nonsignificant. The body length 
was slightly significant (P<0.05), the head crown, 
humerus and femur lengths were moderately signifi¬ 
cant (PO.Ol), while all other measurements were 
strongly to highly significant (P<0.001). Means and 
standard deviations are reported in Tables lAand IB; 
histograms defining the 95% confidence intervals 
for all measurements are located in Appendix Id. 

Mitochondrial DNA sequence data were com¬ 
pleted for two fragments, D-loop and PAST fragment 
(approximately 2380 bp) for 98 individuals, repre¬ 
senting all six recognized species of woolly lemurs 
from a total of twelve sites (Fig. 1; Appendix II). All 
new mtDNA sequences generated for this study were 
deposited in GenBank and can be acquired through 
the accession number (Appendix la; Appendix II). 
The sequence alignments for the data sets are avail¬ 
able from the first author upon request. The PAST 
fragment consists of the 3' end of the COIII gene (30 
bp), the complete NADH-dehydrogenase subunits 
ND3 (348 bp), ND4L (297 bp), and ND4 (1378 bp), 
along with the tRNAgenes, glycine (73 bp), arginine 
(73 bp), histidine (70 bp), serine (65 bp), and the 
5’ portion of leucine (47 bp). The polyadenylation 
of COIII and ND4 genes, insertion of base pairs 
between ingroup/outgroup comparisons, and other 
alignment characteristics between lemurs and Homo 
are consistent with Pastorini et al. (2000). 

Based on the phylogenetic inferences of the NJ, 
MP, and ML analyses of three sequence alignments 
(D-loop. PAST, and D-Loop-PAST fragment com¬ 
bined), two major Avahi subgroups are represented, 
differentiating the six recognized woolly lemur spe¬ 
cies (Figs. 8-14). The first subgroup corresponds 
to the western woolly lemurs, A occidentalism A. 
cleesei , and A. unicolor (Fig. 8). The second sub¬ 
group includes the eastern woolly lemurs, A. me¬ 
ridional is meridional is, A. m. ramanantsoavana, A. 
peyrierasi , and A, laniger (Fig. 8). Two haplotype 
groups or types of A. peyrierasi were represented 


within the eastern woolly lemurs (Figs. 8-14). In 
addition, another group of woolly lemurs from the 
Fandriana region formed a distinct clade, A. species 
nova #1, from the other recognized species (Fig. 8). 
There is high bootstrap support for the MP and NJ 
analysis with respect to the topology of the genera 
and species as every major node between the species 
clusters has a greater than 50% bootstrap support 
(Figs. 8, 11, and 13). The results from the popula¬ 
tion aggregate analysis of the D-loop and PAST se¬ 
quence data are presented in Tables 2A-B and 3 A-B, 
respectively. Multiple diagnostic characters define 
each Avahi species, along with two types of Avahi 
laniger (only the results from the PAST fragment 
PAA designates attributes specific for each region), 
two types of Avahi peyrierasi , and the one newly 
described species, A. species nova#l (Figs. 15-17; 
Tables 2 and 3 ). A review of the morphometric data 
for the six recognized species of woolly lemurs are 
summarized in Table 1 and are presented in Appendix 
Id, along with the two types of A, peyrierasi , and 
the newly described species (Appendix la; detailed 
morphological measurements of the individual 
animals are available at http://www.omahazoo. 
com/ccr/index.asp?page=/cci7genetics/genhome. 
htm) . The uncorrected 'p ? distance and the absolute 
genetic differences are presented in Table 4A-B. The 
highest average uncorrected pairwise distances and 
absolute genetic differences for the D-Loop sequence 
alignment were between the western and eastern 
woolly lemurs, ranging from 12.28 to 8.84 and 65 
to 47 (A. cleesei to A. peyrierasi type #2 and A. oc- 
cidentalis to A. peyrierasi #3), respectively. The 
highest average uncorrected pairwise distances and 
absolute genetic differences for the PAST sequence 
alignment were between the western and eastern 
woolly lemurs, ranging from 11.72 to 10.20 and 251 
to 220 (A. occidental is to A. m. meridional is and A. 
occidentalis to A. peyrierasi #3), respectively. The 
highest and lowest average uncorrected pairwise 
distances and absolute genetic differences for the 
D-Loop sequence alignment between the eastern 
woolly lemurs range from 5.99 to 3.43 and 43 to 
19 (A. m. meridionalis to A. laniger and A. species 


(text continued on page 35) 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


13 


nj 

> 

0 

C 

to 

& 

■n 

* ^ 
X 
cd 
> 

< 


to 

fc: 

to- 

Hw, 


te 

“V 

Ol 

Si 

Vj 

F-* 

0 

o 

' -H 

w 

■M 

O 

JO 

< 


Q Q 

-2 w 

5* v3 


St X 
£ 

- Ci 

to tj 

N, ^ 

S 5.: 


c 

to 

P 5 

t) 'J 

2 § 

■§•§ 

v aj 

U ^ 

'*-*+ AJ 

k o 
*-. ■** 

^ 5/ 

c <3 


£■ 


K 

■S 

rt 


t) r* 

^ -0 
■§^5 


r- 
















■4 

f 0 

vc 

frt 

V’i 

r 

vC 

a 

Cv 

ail 

r~ 


■rt 

f^j 

■—i 

so 

O' 

oc 



O'. 



3 

■w 

«0 

rt 

/■% 

o 

Tl 

d 

o 

««* 

o 

d 

o 

d 

d 


ri 

n 

ri 

r^ 

ri 

d 

d 

rn 

ri 



s 

?-• 

M 

rt 

rt- 

rt 

sO 

rt 

r-i 

rt 

00 

rt 

00 

5 

rt 

d 

rt 

J 

p 

3 

11 

rj 

ri 

+’ 

r"^ 

4i 

O 

44 

Tf 

41 

H 

rt 

41 

rt- 

+! 

rt 1 



O 

G 

■J 


d 

ri 

ri 

m 

frt 

frt 

ri 

d 

d 

3 “ 


ri 

rf 

cr 

fr 

r^r 

—* 

ri 

d 


* 














»3 


fO 


f"i 


n 

fi 

rr 

tr 















H 









rt 





rt - 

c- 

rn 

o 

■rt 

— 

ri 

*A 

rt 












> 


rt 

■ 1 


" 

o 

O 

— 

o 

frt 

F- 

d 

— 


r ■ 

O 

O 

rj 

'O 

cr. 

C 

in 


m 

fC 

0 

l-H 

> 


£ 

sd 

rt 

4) 

kJ 

rt 

u 

w 

tl 

l> 

+i 

ri 

w 

4i 

o 

O 

4 

■rt 

4i 

a 

o 

4i 

rt 

d 

rt 

■—■. 

r*-i 

4H 

4 

rt 

j-. 

w - 

d 

— 

1 — 


ri 

d 

ri 

— 

ri 













[ 

'"3 

»“ 

h 

■H 

II 

41 

H 

4- 


+ 

41 

L) 














O 

— 1 

~f 

tT 

c 

oc 

rr 


r i 

r: 


t; 












o 

d 


a 

sij 

d 

ri 

ri 

ri 


_] 

ri 

d 

ri 

8 - 

£> 

£ 

*-• 

X 

-J 


rt; 


n 

v 0 

'A 

v 0 


q 


J 

rt 

CN 

rj 

rj 

ri 

n 

rl 

rt 

n 


G 

o 

c 

£ 

4H 

c 

-H 

o 

41 

o 

rt 

C 

41 

A-? 

41 

4 

a 

4 











X 

"0 

Ll 

y 

<J 

O 

m 

r 

K 

v 0 

in 

rt 


v 0 












rt 

> 

C 


_3 


K 

w 

« 

O' 

d 

d 

Ov 

d 

SC 

> 











< 














c 


(N 

ici 

ri 

vc 

re 


C 

— 

■o 




X 


r-i 

in 

___ 

ITi 

frt 

rj 

wrt 

frt 

«v 

U 

5 

" 

£■*% 

■ti 

o 

II 

c 

■fl 

o 

i- 

ri 

4- 

i 

■w 

-4 

41 



Q 

*=* 

5ft 

p 

/*^S 

£ 


d 

II 

li 

o 

4 

d 

rtl 

Hi 

4 

d 

4 

d 

rtf 

X) 

rrt 

7 


O' 

ri 

O' 


T) 

■o 

■> 


i—i 

y 

rj 

O' 



ri 

o 

C 

C 

n 

(S 

(Z 

o 


u 

o 

d 

VC 

d 

d 

r 

vd 

fs 




J 


ri 

ri 

fn 


rrt 

frt 

rt 

frt 

d 














































































o 

ri 

'A. 

■4 

o 

m 

r- 

VO 

X- 

V, 


X 

X 


rl 

a 

V\ 

rt 

'C 


— 

frt 

n 

■M 

5li 

LJ 

w 

o 

d 

rj 

c 


ri 

o 

o 

d 

1 


d 

« 

sc 

p 

1 / 

£ 

u 

c 

41 

O 

rt 

G" 

d 

41 

O' 

W* 

41 

d 

4 

rt 

rt 

rt- 

o 

d 

41 

cr 

o 

4 


H 

C 

41 

-4 

41 

't 

-H 

tn 

+i 

r- 

ri 

x 

41 

w 

41 

VC 

41 

in 

!U 

£ 

■A 



J 


rtf 

frt 

rrt 

d 

d 

d 

(A 

d 

d 

jj- 


sc 

0 ^ 

K 



c 

cr 

o 

Q 
















w 

o 

d 

.— 

__ 

d 

o 

-=i 


K 

rs 

























% 













7 


Tl 

K 

o 


r- 

O' 

o 

o 

O' 

S 


l/S 
















f I 





d 


■-• 

n 



vC 

c 

OC 

vc 

a 

vc 

in 

a 












o 



Sfj 

G 

d 

c 

w 

c 

Q 


c 

d 

o 












y 



c 

c 

-H 

41 

4! 

4. 

4 

41 

41 

4 

41 














“ 

V 

y 

«/-j 

— 

JJv 



vc 

vC 

frt 

n 












5? 


— 

mX 


d 

VC' 

urt 

d 

d 

d 

VD 

d 

d 














i-*-* 























u 

























x 




















rt 

m 
























* 

0 

Q, 

at: 

4J 

Q. 

!_■ 

r- 

7 



i 


d 

(3 

X 

u 


|S 

c 

rt; 

d 

rt 

d 

K 

d 

rt 

o 

frt 

ri 

ir, 

O 

vO 

c 

r- 

d 








h 

A-r' 

3 

>k 





(U 

4i 

■ 1 


Hi 

4- 

-1 

41 

4 

rt 

4 

4 






r- 



V 

i*V 

W 

Li 


-V 

** o 

a ^ 
2 .« 


'v 

rt 

r“ 

“> 

y 

S-X 1 

<f. 

00 

■•G 

(rt, 

00 

c 

sc 

q 

w 

rj 

ec 

■q 

00 

a, 

d 

vO 

» ! 

CJ» 


J—■ 

- 

_o 

. 

*>-1 

P 

_>T 

c 

i~ 

r- 

5 

*— 

V 

jl 

r- 

r-> 

o 

>k 

> 

r-* 

rt 

5 

r* 

r- 

_C 

jr 

rt 

£ 

M 

^ g 

■s S: 

c 

— 

g 

u ' 

TO 

r“ 

r* 

i—' 

SO 

•'— 

g 1 

fn 

rt 

rt 

o 

-4 

frt 

o 

-H 

r 

d 

4i 

rt 

d 

4i 

rt 

ri 

4 

rt 

d 

4 

VC 

c 

4 

q 

4 

*-* 

i 


— 

w 



o 

> 

0 

> 

s' 

rt 

0 

■-■. 

o 

■> T 

•d A 

0 

fjL 

X 

4J 

y 

V 

oc 

’/*! 

frt 

d 

rt; 

so 

r3 

U' 

t> 

o 

JS 

vc 

d 

IT, 

d 

in 

d 

z 

r" 

0 


5* 

** 

t/5 

/’I 

w 

? 

A 

w 

s 

Q 

> 

J^' 

IZ3 

rt 

Vi 

rt 

LT. 

4-1 

rt 

c 

0 

0 

S ^ 

•3 ^ 

\i 

^ Jr 










r* 

£Ti 


O 

r/l 

o 

d 

C 

o 

o 

r* 

rt 

!U 

r 1 

o 

>■ ^ 

S t 


r\ 

“3 

CJJ 


c 

ri 

d 

rtr 

c 

irt 

w 

n 

o 

._! 

r- 

d 

ri 

d 

<N 

c 

H 


CJ 

V 

t/3 

1 > 

5 

■*—^ 

r Jl 

o 

>. 

o 

P 

rt 

Hh-» 

JJ 

1/5 

0 J 

s: ^ 



rt 

u 

c 

o 

-H 

C 

41 

[S 

-1 

o 

rt 

m 

rt 

frt 

HI 

rt 

4 

r- 

4i 

rt 

H 

frt 

0 


u 

> 

tr, 

o 

Cl 

Q 

V 

r/! 

ca 

^ 0 



- 1 


CY 

ri 

frt 

n 

d 

n 

rrt 

frt 

rv 












-v y 
























V 

^ sC 

i 























2 ^ 





















r. 

■■_! 



o 

I’’* 



4-J 

CO 

Ff 

ri 

o 

ri 

d 

ri 

d 

rt 

d 

ri 

d 

i> 

d 

o 

o 

d 

frt 

d 









-s. 



o > 



*“ 



■H 

■1 

H 

4 

rt 

4 

41 

4 









■-«■ 



"■J - 



4> 

y 

vc 

q 

frt 

vq 

q 

q 

q 

q 

vc 









!3 

C 

i>i 

1 

--, 


5S ^ 

^ s 

ij 


— 

" 



ri 

ri 

ri 

ri 


ri 

ri 

ri 

ri 









t3 

rs 

V, 


SJ 



















ri 

-it 

fO 

=t 

*< 

■-v 

sj 

‘s 



-L a 

VJ 

S 

5> fco 










! 









a 

0 ) 


'-M 


£ o 








ri 

m 

■3 









[X 

>. 

*_■ 

CL 

>i 

**v 



0 g 








it 

« 

Q. 

at 

is 

Cl 

1 

0 

rt 



<U 

— 

5 

Z 

1/5 

o 


s> 

5n 

At 

"*«■» 

y 

' '-s 

A 

| 

\J 

c 

■> 

c 

r- 

■b 

'«- 

r>4 

5 

T®» 

1 ^ 

,fc »i 

trt 

N 

SJ 

S 

rS 

dj 

r% 

1 *>i 

V; 

sJ 

*>s 

■Si 

L 

#\ 

5u 

A 

sr 

_ vj 

d, 

+H 

a 

2 

K. 

*s 

T **m. 

Ak 

JC 

Cl r 

5 1 

<*> 1 
^1 “>bi 

Sj 


a> 

t“ 

£ 

2 

w 


L 

!>■ 

v> 

‘5 

«S* 

■S 

v 

5 

G 

k. 

_y 

■*. 

.bo 

*3 

>■, 

> 

a 

K 

■it 

I 1 

>, 

mJ 

*»»* 

8 

-S 

5f 

£J 

i*. 

?T 

*1 

5 

SI 

L 

? 

A 

r» 

5 

5 

a 

0 

St 

t: 

S 

St 

-c 

u 




C 






2 

A ^ 


r j 











t> 



Vj 

!5 




f-N- 


a 



G 


r 


"Sb 


■XI 

a: 


l; 

■« 

CL 




!-“ 

P 

r* 

A 


»-*■ 

L 

<: >- 


GJ 


■r; 

S 

hi 


> 



a 

0 

V) 


> T 




*-r 



'r 

X 



c. 


L 



> 




r* 

> 









>h d 


to 









X 

































14 


Special Publications, Museum of Texas Tech University 


n. 




—Jiufo 

Xl 


■LiARH .■''■t'to.'IFEJjWlfi.'JH t/tVihm 
SA'VtCJJ- ■Cth-irtTf^tliTt^ ■tl^OF 

I A>ll—Jarwfcr vurk^cila rf/rn'^ntu 
“’I" ttapafeimirptiFctm ffrri’ J wfl nJfr 
|" ■- ttujkiivmw grismi 

^HfeftwSraa*H Hap*t*m*r *iw 


T> * 

jAftli * Pf**p iMiVjiTH-irjiffl,Xi« 

AS A I 10 —Ptoipfafr tctu fvrrU-1-t 
rliaifi’ma 

' 41 r 1 nuwi rt^l 

'"^Fwfuthn uf tottenrailr 
*- Pn>pitk^’ift (tfflfOti 
Art-T i \i\ Jfiki/iicutriMiii* 

* KS * iJi ~*Prftplthrtw wrrvmxt 


.= 

4j 


Avahi peyrtceaii lyp -?*' 


rliwta'^n r irnr.ir IJpf #3* + 


. fraiW tptckd m'nu -1 


stVUki Hi 



AwUi iw mcrittitifTclili T¥ 


Li±Lci3l VehjILy Lcuilit 
(.IiiusiulI Specks IX'sIgfulkn 
Avuf/i tdnigtF 


. hYifrj r.M vijenlafi'i' 


■AN.MJ 


\%-C'icri ilVixill;. Lemur 
lkl|L'.ll.ll SpLLlL- OctiUPl.lllUII 
Auifu «it e hit-uluhi. 


“■ 5 chiles 


tjpQfmr dnfeanMfiu'ft 


Figure 8. Neighbor-joining phylogram derived from the D-loop DNA sequence data from the 
77 Avahi individuals with 26 out-group taxa. Species designated according to the distribution 
in the current literature (Mittermeier et al. 2006; *Thalmann and Geissmann 2000; *Thalmann 
and Geissmann 2005; **Zaramody et al. 2006). Values above branches indicate number of 
changes between nodes. Values within circles indicate support of bootstrap pseudoreplicates. 
Avahi catalogue numbers that are listed in Appendix II, but are not shown in this figure, are 
presented as haplotype information in Appendix lc. 






























































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


15 








liL 


-ji'-K"—HuirA^TiiL* 




■MttHlP— UpanAn r&fri 

=-U-UGI'—fikfliimHkVl rirth-hn 


J±- 


- ari — 8 ■ 


“^^■iS**** 1 C >m n eju. 1 ™ « 



= t tap&fcftlfS JhYli&t 


■ I ' HA Ml Vi: —AtpHHi fitm an/. i> 

iu 14 "3* 

J ™ JtAAL. |Dr^-^ 

I ■ TAMP"^/ 

1 ftOtt. "JV«« c"f*w*rfi‘ 

■ TEAM - —-Pn^fckfcnno Airk»>*Yr 

-lit b| vi-—ipTf^prAkrcii* iLiiLhi ■/. jJEi >.■ 
-IS- HW ?™ £wus Arrirai riynurtn 

*'—AipfiAnilU' Uiwswwrj 




(hh: “1 


Avahi jwyrtenni ivipc £) 


AvakS m-ridi/Mcrit? nrflhnw.iTJSiiHrrtJrftj 


.-h :iJji ffh.TtiiHtmifi* aieridio/mlii 


AvijJu vptNrm; M.y 41 


.■UiMy fmwiT 


.illtnhi iJ'Jii Y.J'iir 

MAH -hid 1*11 1 Cfcwart 

MU I 

ICu 

jjliuAr i.s iJiir.Miui'rL 


Figure 9. Maximum parsimony phylogram derived from D-loop fragment sequence data from 77 Avahi individuals (one of 144 
most parsimonious trees). Values above branches indicate number of changes between nodes. Length = 1,271; Cl = 0.5382; 
R1 = 0.8786; RC = 0.4728; HI = 0.4618. 






































































16 


Special Publications, Museum of Texas Tech University 



ftm 


urn 




//- 


" : MUracebux rtiwiitheiisix 
-- Microcfitus rufitn 

4 i s.j« i ^ _ c;ar« "" r Cheirogateta mtxffw 
-MRAN0229 — CfeirtMtifatf majur 


nfli 1 


ft|5| 


* 


ti.24* 


q m 


■HAN2l-'“" t l‘&red , 0 variegata variegate 


■RAW043- Puiemur fithtia rufm 


Y"tiapatomtr griseus occidcntaUs 


0.4M5 


iiijjhlE/ 


Al 

RANol 38 h' Hapalrmur jimtis 


Ifiipdhuttw grisetix g riwux 


*912 


Ql43» 


■■■ fiapafemur mtwtts 
■ANAEpS .. l.epilemitr unktiFtmimsis 


rJ.-T.K 

v^s—\ 


' turfs/ fruit's 


QuO 

«i.d]5 


u lHM 


^ ®^PRAN0132- Propilhecus edwardri 

Q.ixi'^hIt-TaRJ 4 PstiifitfiMts latkfUhti 

‘ii tasiae.io pemeri 

t £? 7 ^ q | i PrttpiitH'vfvi diadems 

0.SffrBOR2.. k'n-tpsthecitS cotfwtvii 

' UejaMJ .—Propilhecus mursatii 

— Prtspifhectts tlwkrni stnkvffi 
■■ Pmpithet'its rfeokem co.miiaftts 

Pfioptthecta wmrarixi 


O.lKS 

aixijrBEMA4' 
fAM4.7~ 
.MlH 

>MOR££ ■■■■ 






o.ots 


u.rtG£ 


■ft Oil 


B.I40 


Avahi fieyiierusi type #2 
Avatii meridfomtlis raman&rttso&vana 
Avahi merklionalis im’rhfioruilis 
'KfiSSm Avahi peyrierasi typ& U7> 

Avahi species nova #1 

0»AI>. 

M’ialh 

ft.006 
c-iAmis 

Kr J 

i 'lid 

L i| TAD4 :5 
g *1 T:\IM.9 

Avahi laniger 

MIZAIO 



ii /mi 

If 

“H NAKaSPiI 

■NARA4.IQ 


KOM 

unicotor 

DjOftlla W3 


Avahi cleesei 


mtfa 


O.-OiKS 
LUMiJ 


Avahi occidentals 


0,05 substi l uti ora/site 


Figure 10. Maximum-likelihood phylogram derived from D-loop sequence data from 29 Avahi haplotypes. 
The phylogram presented with branch lengths proportional to the number of changes (values specified 
on the branches). We obtained the maximum likelihood phylogram (-In likelihood = 6398.15) from the 
D-loop alignment from a transition/transversions ratio of 2.28 (k = 4.66) and y shape parameter of 0.54. 
(FAN6.6 and FAN6.7 are identical to haplotype FAN2.14; FAN6.9. FAN6.10, and FAN6.11 are identical to 
haplotype FAN2.15; these individuals are not displayed in any of the figures). 






















































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


17 


n 


OK 


T4 


V/~ 


jjr 





121 


l«5 


ITT 


i£L 


il* 


ion 


u 

“7T 


.ANKT -“Jtf/frecc&tw mRMwr^ 
-RAKO2S0 MicFCKthas nifits 


Ok 


— —-iwipmuo --lum 

— 1 i i ABS - - C/J^ragtrfr'iM mewl*? 

. ., RAN022fl—»■ CArirtOj'ii/m.sJ jfnj/cw 
anailj —— j^fuirrtutr (mknirmensis 


v> 


■VK 


■OK 


yA 


lt, , 

■w 


]<j 


iiifc 


JCkl 


IlUANi24 3 

■fcitANomr 

MM 


71 


Q7 


too 


■ j f fd J Pd/ftWW' jrjtouj 

■IrJwows 1 i^ffapaiemur aureus 


141 


J SL 


.3 |”./mW fm/ri . variegaia variegpto 

ka NU3 &-™edmirdsi 
>lOkf*n 'Prvpiihtrcus vemauxi 


ICO L£i 

-BAWWL^ ICQ 

FAN 21 """-Eiitcnmr fuivw; ntfit.% 


—ttqpatwnvr g r grtievs 
^-'-Hitpafemur g, occidentals 


QAR9 


1W 


ICO 


.M 


I no 


ira 


.4vahi peyrierasi type #2 


w 


]?: 


IOG 


100 


SL 


ICO 


S'). 


]£_ 

[17 



Avahi nteridianafis ranmmmtsoavana 


'“pi?, 

mm 


Avahi meridbnafts meridionafis 



u 


M 

R2 

UK , 


2J 


Hr 


t)V; 

I? \\f>67 
\N( 

ANOJM 
K \ Nt 13 .'I i 

fan: m 

J’A\2I5 
IAN? 14 
r\S5 51 
i-w ;i> 

AC >:,:■> 

M 1/ \ if 
M / \ ;■ 

Ml/. AM 
iTADJf- 
LTAD4 i 

, J4V 
Ml/M ; 
NAKA4.I 
NA|?A4.2 t 
AkA-t.M 
\RA4 J) 

aka i 

■ AKA-i Id 
JARA-l.ll 
\ARA-I 1“ 
SARA I \> 
NAHA4 .M 


Avahi peyriurasi type #3 
Avahi species nova U I 


iTAL 

%x 

I-.- 4 -Ml.' 


' F r Vi h.m Avaki ftmigvr 


«■ 


_ 

!CO 


LL 







ANT5.S 
AMJ.'i 

Zp 
rtMi 


m 

& 


— HK’tisinsje* 


111 MAS 
111. MAO 
lil-MAI2 

™,fsfmalj 

liFtKVlA 14 
UAKN 

P®. 
aigj 

MARS* 
MAR*-ft 
M.AKM 


KT i 

— M 

urn 


Avahi unicolor 


Avahi citesei 


Avahi occidcntalis 


Figure 11. Maximum parsimony phylogram derived from PAST fragment sequence data from 77 Avahi individu¬ 
als (one of 53 most parsimonious trees). Values above branches indicate number of changes between nodes. 
Length = 3,551; Cl = 0.4816; R1 = 0.8721; RC = 0.4200; HI = 0.5184. 




























































18 


Special Publications, Museum of Texas Tech University 





psvslobttisls 

ANK 7''' __ ^^-'Microcebta rvfus 

CheiTvgtih'Us ftittjw 

.. jtwjar 

ANAl /- Lppitemar unkmmiemij; 

fe* I *v 1 III " 1 

' -vL)^ ?. Hapakrtmr siffttts 

r. Hapalemiir aureus 

^ cj. griseiix 

,2\\ — HtifitiU'inur g. arcAfetfftaftr 
“ —£rrA»nur futvus mfm 

" Ibft'cHi mrtegata vsricgata 


" 1 “ i? i pi! r" 11 ‘5 Y 1 

cj4s r.toimt "Ptvpithtcus ec/Hur^i 

IRAK 046 

Pm/Wf/lftt/.T L'i.VWdJJdJl'l 1 " 




I MQ 


fcHO 


oil 


MU 


OOHIf, 



Avahi peyrierasi type H 2 


Avahi meridionaiii ranianantsoavana 


; 


Avahi merldiotialis meridianaiis 


IRANI. :r.’ 

I '•; ■ ;■'; . ( A vahi peyrierasi type ff3 

1 AM 13231 

-i an: 14 

Avahi species nova # I 


i.i.wi 


«ID 


0(01 


pBl 

Tvni^ 

['All 3 7 
rAw.zr) 
Ml/.A, 10 
MIZAI2 
MIZAM 
*Diin2 

GW* 

urip^ 

JTA:|>4.9 
: ,.0^\1IZAI3 

NAHA4 ! 

N \H \4 } 
NAK.A4 |3 
NAHA4 •! '• 
MARA-1.12 

SSKS:W 

NARA4. 


Avahi iaitiger 


(ym 


n m 


mi 


Jf 



<i.h*3 


— 0.01 sutwiLTulifidii'Siw 


m ri s 

ntm 2 unicofor 

,M5 10 


PIFMAS 

™i M Avafii cleesei 

0.001 HI: MAI 3 
111; MA14 

j j ^p* Avahi occidenttUls 

MAR? 

MAK5S 
MAHM 


Figure 12. Maximum-likelihood phylogram derived from PAST sequence data from 77 Avahi individuals. The 
phylogram presented with branch lengths proportional to the number of changes (values specified on the branches). 
We obtained the maximum likelihood phylogram (-In likelihood = 18,123.61) from the PAST alignment from 
a transition/transversions ratio of 5.94 (k = 12.31) and y shape parameter of 0.34. 

































































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


19 



iii 

too 


100 


■k a SO.U2-"*-" Piifpiittvi-iis tnJwanf.*i 

, tAGRtii-'—Propithecus venvauxi 


DO 

i 1 n ■ 


so 




IK 


jKANOfiT 

Ukanoiw 

100 

All 

ZfAN2.I4 

Tan 2.15 


100 5 


1AD1 
TAD 2 

fcp Hjfl'JTAIXn 

Tumizaio 

-ZTADiti 
kT.4D4.3 
7 iMIZAl 3 
iJTADLS 

Hiaiw ) 

NARA4I 
\ARaL2 

]Ki|t/NAR,A4.L0 
^NARAL 11 



Avahi peyrierasi type #3 


Avahi meridionaUs ramananisoavana 


Avahi mendionaiis rtteridffiinilfs 

Avahi peyrierasi type #2 
Avahi species nova #1 


Avahi laniger 


50 changes 


MT 

UNJ 


jaiANTS.g 

■^KtAXTSlO 

I jA ABEMAS 

raiid m;u ^ 

jSpBEMAU 


L2J 

*2 


JUMAR29 

IOOUMAR52 


unicolor 
Avahi cleesei 
Avahi occidentals 


Figure 13. Neighbor-joining phylogram derived from the D-loop and PAST combined DNA sequence data from the 39 Avahi 
haplotypes with 19 out-group taxa. Values above branches indicate number of changes between nodes. Values within circles 
indicate support of bootstrap pseudoreplicates. 


















































20 


Special Publications, Museum of Texas Tech University 


2IK 


144 


U-J 


35J 


]-WS 


//- 


1*7 




94 


Kb 


■ank.7. Micrvtebun ruivlabett&it 

—RAHQ 250 — Mlcrocfbus mfits 
—-CpA ftH Cbeirovtfieus nieriiiix 


m 


124 


[74 


L 02 


79 


-RAH0233 Cfti'imgateiiii nit i/or 

>KlAM24 = , 

_Jgj ^ n jj simiLS 

_Jiil_rftAfflH 52 *—Hapaltmur timcit? 


m 


RANTMI 


ITS 



i?-— Hapatemurg. griseuf 


219 


UiAS-il 2 23!““ Haptdermtrg, occid&italis 
■■MANtMS —Euimmr fiih'sm nifux 


m 


LW 


164 


L31 


M | j ii ■ 

"Ei MIZAJ.31“ " JndA intfri 


■fan? I—— Varecia variegata 
— ANALi -. Lvfiitemur ankiirvttwnsi* 


I2K 


■RANUflE. Propifht'cua cdwartisi 

-MoRW""' Propiihecm vcrrctntxi 


2lfi 


- JOghjin^fH 




J 

u 

■— 

Vj 

■5 

a 

E 


v> 

—■ 

tu 


1KANCM4. 
JVOP5.H 
t’243 
_ LiRAMtni'JH 



m 



Avahipeyrierasi type J^3 


Avahi meridionalis ramanantsoavana 

Avahi merklio/iaiix meridionals 

Avahi peyriemsi type l >2 
Avahi species nova U 3 


ji 


IWOl 
i .TADS 

X ™» 

M BTAD37 

Imizaio 

ri J-T,\DM 

f, -TAD4.3 
— SlTAIM.tf 
JTAUJ. 9 

“MiZAO 
TffNARjM.I 
nplNARA4.2 

IIt/naRAAIG 

MsARAAII 


Avahi ianiger 


n 


Western Avahi species 


M; 


29£ANT5,8 
' ANT5-.I0 


Aft f &EMAK 
rnnililMA4 


Avahi imicohr 
Avahi cleesei 


111 “lilTMAU 

ISmarIs Avahi occidentals 


Figure 14. Maximum parsimony phylogram derived from the D-loop and PAST combined DNA sequence data from the 39 
Avahi haplotypes with 19 out-group taxa (one of 20 most parsimonious trees). Values above branches indicate number of 
changes between nodes. Length = 4,999; Cl = 0.5141; Ri = 0.8392; RC = 0.4314; HI = 0.4859. 




























































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


21 


Table 2A. Diagnostic nucleotide sites from the D-Loop Pairwise Aggregate Analysis 
(PAA) of Avahi . ___ 

1111111122222222233333333333344455555555 

1260155799927777889900011333349902900002244 

6046289245975679785602934234686712925671538 


RAN06 6 

ATCGAAAACACAGGAATTTAAGTCCTCTACAGCCAAAAATCGG 

RAN0319B 





. .c. 


RAN03 4 8 

RAN02.10 

V0P2.13 

VOP2.14 

V0P2.15 





. .c. 


RAN067 


. . . ."TC.. 

..,T... 


. T . G . .. .. 

. . GG.C 

HANOI 9 9 


... * ^TC. . 

..,T... 


. T . G. . . . 

. . GG.C 

RAN0320B 


....TTC*. 

...T... 


. T . G. . . 

. . GG.C 

RAN0261 

m 

....TTC.. 

. . . T . . . 


.T.G... 

. . GG.C 

I486 


..G."ACT. 

, , . T . . . 


.T. 

. .GG. . . T. . 

M89 


..G.TACT. 

. . . T, . , 


. T. 

..GG...T.. 

M1G7 


..G.TACT. 

...T... 


. T. 

..GG...T.. 

Ml 08 


..G.TACT. 

. . . T , . . 


. T. 

..GG...T.- 

Mil 9 


..G.TACT. 

. . . T. . . 


.T. 

..GG...T.. 

M150 


..G.TACT. 

. . . T. . . 


.T. 

..GG...T.. 

Ml 55 


..G.TACT. 

. . . T. . . 


,,T. 

..GG...T.. 

Ml 59 


..G.TACT. 

. . . T. . . 


.T. 

. . GG T . . 

MAB4.8 


..G.TACT. 

. . . T. . . 


.T. 


MAB4.10 


..G.TACT. 

. . .T. . . 


.T. 

..GG...T.. 

FAN2.14 

. c. 

....TTC.G 

. . T. . . . 

. . . C. 

.TC.T.. 

. .GG. .C. . . 

FAN2.15 

.c. 

....TTC.G 

..T.... 

. . .C. 

.TC.T.. 

..GG..C... 

FAN2.19 

.c. 

....TTC.G 

, . T . . . . 

. . .C. 

.TC.T.. 


FAN2.2 0 

.c. 

....TTC.G 

. . T . . . . 

. . .C. 

..TC.T.. 

..GG..C... 

FAN2.21 

-C . 

....TTC.G 

. . T . . . . 

.. . c. 

..TC.T.. 

..GG..C... 

TAD1 


....TTC.. 

C . . T . . . 


T 

. .GG.... A. 

TAD 2 


....TTC.. 

C . . T . . . 


. .T. 

. . GG .... A. 

TAD 3 


. . . ,TTC.. 

C . . T . . . 


. . T. 

.. GG. ...A. 

TAD 19 


,...TTC.. 

C . . T . . . 


. . T. 

, , GG . . . . A . 

TAD 3 6 

. 

.G. .TTC.. 

C. .T- - - 


. . T. 

. . GG.... A. 

TAD 3 7 

* 

....TTC.. 

C..T... 


. . T. 

. .GG.... A. 

TAD4.3 

m m m 

.G..TTC.. 

C..T... 


. .T. 

. .GG.... A. 

TAD4.8 

* ■* * 

.G..TTC.. 

C..T... 


. .T. 

..GG....A. 

TAD4.9 

■ 9 * 

.G.,TTC.. 

C..T... 


. .T. 

...GG....A. 

TAD4.2 0 


....TTC.. 

C . . T . , . 


. . T. 

...GG....A. 

MIZA10 


....TTC.. 

C..T... 


. . T. 

. . .GG.... A. 

MIZA12 


....TTC.. 

C . . T . . . 


. . T. 

...GG....A. 

MIZA14 


....TTC.. 

C. .T. .. 


. .T . 

. . . GG.... A. 

MIZA13 


.G..TTC.. 

C. .T. .. 


. .T. 

. . . GG.... A. 


















































































22 


Special Publications, Museum of Texas Tech University 


Table 2A. (cant.) _____ 

1111111122222222233333333333344455555555 

1260155799927777889900011333349902900002244 

6046289245975679785602934234686712925671538 


AND4 

G 

. T , G * 

GTTC. 


.T. 

.T. . 

....T.GGG 

AND 5 

G 

. T . G . 

GTTC . 


.T. 

.T. . 

....T.GGG 

AND 6 

G 

. T . G . 

GTTC. 


. T . 

.T. . 

....T.GGG 

AND 11 

G 

. T . G . 

GTTC. 


. T . 


....T.GGG 

AND12 

G 

. T . G . 

GTTC . 


. T . 

.T. . 

.T.GGG 

AND 13 

G 

. T . G . 

GTTC. 


.T. 

.T. . 

. . . .T.GGG 

AND 14 

G 

. T . G . 

GTTC. 


. T. 

.T. . 

. . . .T.GGG 

AND 19 

G 

. T. G. 

GTTC. 


.T. 

.T. . 

...,T.GGG 

AND3 3 

G 

-T.G. 

GTTC. 


.T. 

. ..T . . 

,...T.GGG 

AND34 

G 

. T . G . 

GTTC . 


. T. 

.T. . 

.T.GGG 

NARA4.1 



. TTC . 

.C. 

.T . 

.T. . 

.GG . 

NARA4.2 



. TTC . 

.C. 

. T. 

.T. . 

.GG. 

NARA4.10 



. TTC . 

.c. 

.T. 

.T. . 

.GG. 

NARA4.11 



. TTC . 

-C. 

.T. 

.T. . 

.GG. 

NARA4.13 



.TTC. 

-C. 

. T. 

.T. . 

.GG. 

NARA4.17 



.TTC. 

.C. 

. T. 

. T. . 

......GG. 

NARA4.18 



.TTC. 

.c. 

. T. 

. T. . 

.. .GG. 

NARA4.2 3 



.TTC. 

.c. 

. T . 

.T. . 

.GG. 

NARA4.31 



.TTC. 

. c. 

. T . 

. T. . 

......GG. 

NARA4.3 2 



. TTC. 

.c. 

. T . 

. T . . 

.GG . 

ANTS.8 

• 

. .A. . 

. TTC . 

. c. 

. T . 

C.T . . TG . 

.GAT..GG. 

ANTS.9 

* 

. . A. . 

. TTC. 

.c. 

.T. 

C.T. .TG. 

.GAT..GG. 

ANTS.10 

* 

. .A. . 

.TTC. 

. c. 

. T . 

C.T . . TG. 

.GAT..GG. 

ANTS.12 

. 

. . A . . 

.TTC. 

.c. 

. T. 

C .....T..TG. 

.GAT..GG. 

BEMA8 

• 

. A . C . 

.TTC. 

. AA 

. cc 

...GA..*CTG. 

.. C ...GG. 

BEMA9 

■ 

,A,C. 

.TTC. 

.AA 

. cc 

...GA...CTG. 

. * C , . .GG. 

BEMA12 

• 

. A. C . 

.TTC . 

.AA 

. cc 

...GA...CTG. 

..C...GG. 

BEMA13 

- 

.A.C. 

. TTC . 

. AA 

. cc 

...GA...CTG. 

.. C ...GG. 

BEMA14 

* 

.A.C. 

. TTC . 

. AA 

. cc 

...GA...CTG. 

..C...GG. 

MAR2 9 



. TTC . 

-C. 

. T. 

. CG.T . TG . 

..C..GGG. 

MAR4 6 



.TTC. 

.C. 

. T. 

.CG.... T .TG. 

. . C. .GGG. 

MAR52 



.TTC, 

. c. 

. T . 

.CG....T.TG. 

. . C . .GGG. 

MAR54 



.TTC. 

.c. 

.T. 

.CG.... T .TG. 

. . C . . GGG . 

MAR5 5 

- 


.TTC. 

. c. 

.T. 

. CG .... T . TG . 

..C.. GGG . 

MARS 6 



.TTC. 

.c. 

. T. 

.CG....T.TG. 

..C.. GGG . 

MAR6 0 



. TTC. 

.c. 

,T. 

.CG....T.TG. 

.. C..GGG . 

MAR61 



. TTC . 

. c . 

. T . 

.CG....T.TG. 

..C.. GGG . 





























































































Tabl e 2B, Diagnostic nucleotide sites fro m the PAST Pairwise Aggregate Analysis (PAA) q/Ava hi. 


Andriantompohavana et al.— Woolly Lemurs of Madagascar 


23 


o\ oo 
o\ \> 
ch vo 
a\ in 
a\ lo 

Ch LO 

ov, 

a> ^ 
Ch co 
ov co 

CM 
0\ CM 

0% i—1 

OV iH 
CO 

CO CO 
00 CO 
CO CM 
O 00 

r- oo> 
t> vd 
t> o 
r- o 
[> o 
vo co 
vo 0 

VO CO 
VD CO 
LiO CTi 
m i> 
LD l> 
ID 

in cm 
o 
o 
co 

co co 
co co 

CM CO 
CM CO 
CM l> 

cm m 

(Ml 

CM i—l 
(H LO 
i—I CO 
rH CM 

t— t i—! 
i—I i—I 
i—I i—I 
rH O 
rH CD 

o\ 

CO 

\> 

LO 

CM 


L0 

LO 


LO 

CM 

CM 

00 

0 

CM 

LO 

O 

CO 

in 

co 

o 

VD 

O 

O 

co 

LD 

VD 

L0 

CO 

CO 

M 1 

r-i 

CO 

i—! 

m 

VD 
o 
VQ 
CM 
O 
CM 
i”t 

o 

m 

VD 
<—I 

m 

o\ 

co 

VD 

CO 

in 

co 

i—i 
00 
■sF 
I—I 
00 
CM 
CO 
LD 
LT) 

l> 


o 

< 

0 

H 

< 

U 

< 

u 

0 

< 

Eh 

0 

a 

a 

< 

o 

o 

0 

Eh 

Eh 

Eh 

U 

<C 

0 

o 

o 

< 

u 

< 

u 

o 

< 

0 

F—l 

u 


0000 


0000000000 


O0000000OOOOOO0O00 

* • * 'hhHHHHHHHE 1 * * * • 

* * * 'HHhhHHHhhB ■ • * • 


< < << < 


<3 < <3 


. 


000000000000000000 

■ » # # H *4 4 * » 


uooooooooooooouooo 

.* * ■ * H Eh Eh Eh 


■ ii 


if* 


■ * ■ *EHHE“'E- | E- , E- , E- , EhEhEh 

O O O O. 

000000000000000000 


<3 


i<C ^ 


oooooooooooooooooo 
o a o o. 


av 

< 











O 

o 

0 

o 

0 

0 

0 

0 

0 

0 

# 

A 

* 

■ 

sr 

H 

4 

* 

» 

* 

* 

■ 

o 

a 

o 

o 

a 

o 

o 

o 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

co 

O 

* 

■ 

■ 

■ 

m 

■ 

■ 


















VD 

o 

* 


























lQ 


o 
























o\ 

co 

I-1 

CO 


in 



t—1 

o 










O 


in 

a\ 

!—1 


VD 

I—1 


* 

t—i 

(—1 

!—t 

l> 

0V 

VD 

CM 









00 

1-1 

I-1 


1—1 

CM 


VD 

CO 

CO 

CM 

* 

* 

> 1 ' 

VD 

r-i 

CM 

CO 



X 

■Q 

X) 

Xi 

X! 









O 

O 

O 

o 

CM 

CM 

CM 

o 

o 

o 

o 


X) 

r- 

00 

av 

o 

L0 

CO 

M* 

sP 

CM 

0 

CM 

CM 



CL CL CL 

o o o 
> > > 



vocnoo^HinmLncQaQ 

oo co i—it—ii—it—ii—ii— 


&L pLj pL| 







































































24 


Special Publications, Museum of Texas Tech University 





03 

00 

LO 


























o\ 

l> 

CM 


























CT\ 

VO 

CM 


























03 

LO 

00 
















o 

a 

CJ 

u 

u 

o 

u 

a 

u 

u 

m 

LO 

\> 

■ 

o 

o 

o 

o 

o 

O 

O 

O 

O 

O 

o 

o 

d 

d 










* 

G\ 

LO 

CM 

* 















Eh 


Eh 

Eh 

Eh 

Eh 

Eh 

H 

Eh 

Eh 

m 


LO 

u 

o 

o 

o 

0 

o 

o 

o 

d 

d 

d 

d 

d 

o 

u 

0 

0 

O 

a 

o 

a 

O 

O 

O 

O 

ov 


O 


























c\ 

CO 

CO 


























m 

CO 

LO 
















H 

Eh 

Eh 

Eh 

Eh 

Eh 

£h 

Eh 

Eh 

H 

o> 

CN 

03 


























o\ 

CM 

O 

< 

























m 

s—l 

VD 


























m 

s—1 

o 


























00 


o 

< 















o 

o 

O 

O 

O 

o 

O 

O 

O 

o 

CO 

CO 

CD 

























CO 

CO 

LO- 


























CO 

CM 

VO 


























o 

00 

LO 1 



























CO 

CO' 


























i> 

VD 



























!> 

O 

CO 
















< 

< 


< 

< 

< 

< 

< 

< 

< 

O 

O 

*sP 


























O 

o 

t—1 


























VO 

a\ 

CO 

h 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

U< 

Eh 

U< 

Eh 

Eh 

Eh 

VO 

r- 

rH 

• 

< 


< 

< 

< 

*< 

<1 

<c 


C 

< 

< 

< 

< 











VO 

VD 

L0 


























VO 

CO 

VO 


























in 

03 

o 

o 

U 

u 

U 

U 

U 

U 

u 

o 

O 

U 

u 

u 

u 

u 

O 

U 

d 

d 

u 

U 

O 

U 

U 

U 

LD 

o 

VO 


























lh 

o 

CM 

< 

< 

< 

< 

< 

d 

< 

< 

< 

rfj 

< 

< 

<c 

< 

< 

< 

< 

d 


< 

< 

<C 

<C 

< 

< 

LO 

sr 

o 


























LO 

CM 

CM 


























to 

o 

rH 


























to 

o 

o 


























CO 

sP 


u 

H 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

E — ! 

Eh 

Eh 

Eh 

Eh 

o 

U 

a 

a 

u 

a 

u 

U 

o 

u 

CO 

C0 

av 

H 















o 

O 

o 

o 

u 

O 

o 

a 

o 

o 

CO 

CO 

vo 

























CN 

u\ 

5- 1 
















o 

o 

o 

o 

o 

d 

o 

d 

d 

o 

CM 

CO 

03 
















Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

H 

Eh 

Eh 

CM 

r- 

m 

# 
























* 

CM 

LO 

co 


























CM 


VD 


























CM 

rHl 

CO 


























1 - 1 

LO 

LO 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

Eh 

£h 

H 

Eh 

H 

Eh 

Eh 

*- 1 

CO 

CO 


























*—1 

CM 

X - 1 


























i™H 

I-1 

00 


























t —\ 

rH 



























x—\ 

x —! 

i—1 


























x—1 

o 

00 

< 

























i—1 

o 

CM 



























03 

CO 



























00 

LO 
















d 

d 

d 

o 

d 

O 

o 

O 

O 

U 


o 

LO 

U 

a 

O 

O 

U 

U 

U 

O 

U 

0 

0 

a 

U 

a 

O 

u 

O 

u 

u 

o 

o 

CJ 

O 

u 

u 


L0 





























l> 



























CM 

03 : 



























rH 

'Np 

u 

a 

u 

u 

a 

O 

a 

U 

0 

O 

u 

a 

0 

a 

a 

u 

u 

u 

u 

u 

u 

u 

a 

u 

u 


CO 

VD 


O 

cm m 

• ov vd [■"- 

Q Q Q P P Q Q 

< <c <C <C < 


o 

CO CPs CM O 03 co ^ 

* • 'I—I I—Is—I s—I 

QnnNt^NNQ 

tfJrflrfjMMMIHS 


h o] n ^ n ^ 

LO VO i —\ i—t i—I r—J r ~I 00 CO 


QQQQQQQOQ 





























































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


25 


s; 

Aj 

<~m 

£ 


Ch 

00 

LO 

a\ 

r- 

CM 

<T\ 

CD 

CM 

<j\ 

m 

CO 

(T\ 

Lfl 

r- 

<J\ 

m 

CM 

ac 


LD 

G\ 


O 


CO 

CO 

CO 

CO 

LO 

<J\ 

CM 

00 

CO 

CM 

o 

CO 

rH 

CD 

co 

H 

o 

00 


o 

CO 

CO 

00 

CO 

CO 

LD 

CO 

CM 

CD 

l> 

CO 

LD 

l> 

CO 

ro 


CO 


i> 

o 

00 

i r- 

o 


i> 

o 

1—1 

CD 

co 

CO 

CD 

i> 

X-1 

CD 

CD 

LD 

CD 

CO 

CD 

in 

a\ 

O 

ld 

O 

CD 

LD 

i> 

CM 

LO 


O 

in 

CM 

CM 

ld 

O 

i—1 

LO 

O 

O 

ro 



CO 

CO 

CPi 

ro 

CO 

LD 

CM 

co 

rH 

CM 

co 

Cft 

CM 

r~- 

CPi 

CM 

ID 

CO 

CM 


CD 

CM 

i—1 

CO 

rH 

LD 

LD 

r { 

CO 

ro 

i— 1 

CM 

1—f 

T —{ 

i—1 

CO 

1-1 

t—! 


1 - 1 

T—1 

1—t 

H 

o 

00 

i — 1 

o 

CM 


co 

CO 


00 

LO 


o 

LO 


in 

-sF 


M 1 

o 


CM 

O 


i—t 




00 



CD 


* * ■ 

* * •■ 


0 000000000000000000000000 


■ * 


uuuo<]i<i:tf:<Ci«:uuouuu 


H H H H.. • 




U U U U O 


H Eh H H B H 

O U O O 6 U 

U U O O U U 


■ * * *.o o o o o. 

fHIHHlHL-‘iHIHIHHEHEHEHEHEH£HE-'E- , E-iE-!E-HEHEH[HE-'E-‘ 

*..o o o o o o 

.<C <3 <C <£ ■ *■*•*••*• 

OUOUQOOUUUBBEhBEhEhBBBBHHHHH 

BHHHHHHHHB. 

.*.- - * - o o o o o o 

.<. 

.U O O O.. 

..f< <! f< 

BHBHBHHBBHUOUOUUUUOUUOUUU 


HHHHHHhhHhhEHhhh 

- ■ ■ ‘OOOOO. 


.< < <£, <; 


< <c <c »< <c 

EhEhEhEh£hEhEhEhHEhEh 


o o o o 


U U O u o 


o o o o o o 


B 0 
Eh Eh 
O O 


H H 
H Eh 

o o 


.<C <£ <3 < < 

HHEhE-<EhHHEhEhHH 


ooououoouuuuuo 


uoooouooouu 
■ * * ■ * o u u u u u 


oooouuoouuuu 

. ■ • <c < 


u u 
< < 


uuououuuuuu 
t< < <c «< <c. 


oi-ipor-'CororHCM 
i—! CM HrHHHHOJnn 


hacj <c! <C ^ <C f=^C 


O CM 

co cn i—i ri cm ro ■sT* 

* ■ ■ >COO\HHHO^lDCN^^lD 

LDLDiDiD<<£<*<t!<cM^LnLninLD 










































































26 


Special Publications, Museum of Texas Tech University 




PC 


e2 


o\ 00 
0^ d 
CTi VO 
Ch, IT) 
Ch ED 
Ch ID 

<Tt 

0> ^ 
&\ CO 

o\ d 
o> r\] 
0> CM 
CJ\ rH 
tH 
CO ^ 

co d 

oo d 


LD 

CM 

CM 

cc 

d 

CM 

ID 

O 

00 

LD 

00 

o 

VD 

O 

d 

OO 

ID 


•4 ft 

ft P 

o o 

* 4 

* * 

U U 

H H 


co 

d 

ID 

CM 


LD 

LO'U U 

d 0 0 

o\ 

^ u u 

oo 
00 


O rH 
VD VO 


CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
CM 
(—I 
<—I 

t—I 


CO ID LD 
CO CD ri 
iH ID ro 
tH cl co 
t—l d i—l 

H CM CM 
<—1 i—I co 

i—It—I i—! 
O D LO 
O LD CD 
o in d 

d CM 


o 

o 


d o 


O H d 

oo vo o 
cn ^ vo 

00 CO VD 

co d 

00 d 
00 VD 
CO ^ 

co d d 

CO d ID 


CM 

o 

<—I 

o\ 


00 


CO 


H H 


H 


i—! O 


d h 
H CM 
i—I t—I d 
H i—I M* 
O d 
O VO 
ID 


LD 

O 

d 


s; h o id d 
o 

.Vi 


<N 

£ 


H 

Eh 

< 

0 

E-* 

0 


02 


CO 

CM 

vo 

Eh 

Eh 

x —f 

co 

T-1 

d 

< 



4 

4 

4 






d 

CO 

in 

* 

4 

x—3 

CO 

O 

d 

O 




4 

4 

4 

* 

4 

* 

4 

d 

CO 

d 

0 

0 

r—1 

d 

CO 

vo 


m 

1 

» 

4 

* 

4 

• 




d 

VO 


0 

0 

x —) 

d. 

d 

rH 

d 


« 

4 

4 






4 

d 

o 

CO 

• 

# 

x—1 


O 

CO 

Eh 





4 

4 

4 

4 

41 

* 

d 

o 


* 

* 

<—1 

VD 

rH 

CM 

0 



* 

4 

4 

* 

4 




d 

o 

T—1 

• 

- 

x—1 

LD 

C0 

LD 

0 



4 

4 

4 





ft 

VO 

CT\ 

CO 

H 

Eh 

i—1 

LD 

CO 



4 






0 

0 

Q 

o 

VO 

d 

rH 

. 

. 

rH 

LD 

ID 

CM 












VO 

VO 

LD 

o 

0 

T—' 

ID 

d 

d 

0 





4 

4 

< 

< 



VO 

d 

VI) 

* 

■ 

rH 

in 

CM 

LD 

0 

4 

4 

4 

4 

4 


Eh 

Eh 

Eh 

Eh 

i.n 

o\ 

O 

Eh 

[h 

rH 

ID 

^ - \ 

o\ 


* 

4 

4 

4 

4 

# 



A 

* 

LD 

d 

vo 

• 

* 

\—\ 


d 

d 

0 

* 

4 

4 

4 






# 

ID 

d 

CM 

< 

< 

i—1 


L0 

CT\ 

d 

4 







4 

4 

* 

ID 


O 

0 

0 

X —1 


LO 


0 



4 

4 

4 

4 

4> 


4 


ID 

CM 

CM 

* 

* 

rH 


O 

CO 

H 

fe 

* 

4 

4 

4 


0 

0 

0 

0 

ID 

O 

rH 

* 

* 

rH 


o 

d 

Eh 







4 

4 

4- 

■4 

LD 

o 

o 

< 

< 

i— \ 

d 

O') 

d 

0 



4 

4 

4 

■ 

4 

4 

■ 

* 

d 

St 1 


0 

0 

rH 

d 

o\ 

o 

< 

It 

4 

4 

4 







d 

d 

o\ 

» 

■ 

rH 

d 

00 


Eh 






4 

4 

4 

* 

4 

d 

d 

w 

* 

■ 

f—1 

d 

CO 

rH 

< 


4 

1 

* 

4 

4 

* 

4 

W 

V 

CM 

o> 

X—1 


Eh 

*—\ 

d 

VO 

d 

0 

4 

■ 







4 

ft 

CM 

co 

G\ 


- 

rH 

d 

ID 

d 

0 



* 

4 

4 

4 

0 

0 

0 

0 

CM 

d 

G\ 

. 

* 

i '—^ 

d 


rH 

Eh 

4 

» 

• 

M 

4 


0 

0 

0 

0 

CM 

D 

CO 

• 

■ 

rH 

d 

d 

o\ 

< 

# 







* 

4 


CM 


vo 

■■ 

■ 

rH 

d 

d 

0 

0 

* 

4 

4 

4 







CM 

x—1 

d 

. 

» 

rH 

d 

d 

d 

H 

4 

4 

4 

4 

■ 



■ 

m 


H 

LD 

ID 

Eh 

Eh 

rH 

CM 

d 

o^ 

0 







m 

4 

4 


T—1 

d 

d 

. 

■ 

t—i 

CM 

d 

d 

0 


4 

4 








1—1 

CM 

i—1 

0 

0 

rH 

CM 

d 

0 

Eh 

* 

4 

4 

4- 

4 






1—1 

I-1 

co 

k 

* 

x—1 

CM 

vo 

rH 

Eh 

* 

4 









T—1 

rH 

'st* 

* 

* 

x—1 

CM 

x—l 

d 

0 





* 

4 

4 




T — 1 

t— i 

[—1 

i< 

< 

(—i 

rH 

vo 

co 

CJ 


« 

4 

# 

4 

4 

4 

4 



rH 

O 

co 

H 

H 

rH 

x —1 

d 

CJ\ 

H 



4 

4 

4 


< 

< 

< 

< 

i—i 

o 

CM 

Eh 

Eh 

x—i 

x—1 

d 

CO 

Eh 







4 

4 

■4 



CA 

d 

* 

* 

rH 

rH 

d 

LD 

< 



4 

4 

4 

4 

4 

4 

4 



0 

H 

0 

U 

Eh 

H 

H 

Eh 

< 

0 

O 

o 


E-i H H H 


Eh H H H 


E-| h h H 
< < < < 


0000 


0000 


Eh E- Eh H 

Eh Eh H H 


0 0 O 


O 



O) 

CO 

x — i 

no 


LD 


CTi 

T — 1 

o 

vo 

T . —1 


« 

T—1 

i—i 

<—1 

d 

cr> 

vo 

CM 

vo 

d 

d 

CM 

* 

* 

* 

vo 

i — 1 

CM 

d 

O 

O 

O 

O 

CM 

CM 

CM 

O 

0 

O 

0 



P-t P-i P-i 

O O O 

> > > 











































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


27 



CM 

ro 

un 

LD 


eg 

ro 

ro 

T— ! 


CM 

rH 

LO 

CO 


CM 

rH 

CO 

CO 


CM 

:—\ 

ro 

\ —1 


CM 

1—1 

CM 

CM 


CM 

!—! 

rH 

VO 


CM 

rH 

i—1 

rH 


CM 

o 

CT» 

VO 


CM 

o 

LD 



CM 

o 

LT) 

ro 


CM 

o 

CO 

CM 


CM 

o 

CO 

G 


CM 

o 

rH 

CO 


< —\ 

CO 

VO 

o 


x—l 

o\ 


VO 


?— l 

CO 

03 

VO 


tH 

CO 

l> 

CM 


I—£ 

CO 

O 

O 


T —l 

CO 

VO 

rH 


T— E 

00 

MT 

oo 


T—1 

CO 

CO 

r 


I—1 

00 

CO 

ID 


l—1 

CO 

rH 

CO 


T —II 

00 

1-1 

CO 


f—1 

CO 

O 

o 


I—1 

r- 

00 

VO 


rH 

r- 

o 

1—1 


rH 

r- 

o 

00 


T — 1 

CO 

T — 1 

CM 


l — 1 

LO 

00 

LD 


rH 

If) 

CO 



rH 

in 

LO 

CM 


i—1 

LT) 

CO 

O 


i —l 

in 

CM 

LD 


T — 1 

id 

rH 

av 


1—1 


O 

r- 


rH 


LTj 

a\ 


x—\ 


in 



rH 


o 

CO 


i—i 


o 

I> 


x —1 

CO 

av 

r~ 


i—1 

CO 

av 

o 


x —1 

ro 

00 



x —1 

CO 

a) 

x —1 


x — 1 

ro 

vo 

CO 


X — i 

CO 

(JO 

CO 


X —1 

CO 

'M 1 

!-1 


I- \ 

CO 

ro 

m 


rH 

CO 

ro 

vo 


rH 

cn 

ro 

co 


rH 

CM 

O 

CO 


e—1 

CM 

O 

CO 


T—1 

CM 

O 

o 


1-1 

CM 

VO 

l—1 


x —1 

CM 

rH 

CO 


X—\ 

rH 

VO 

00 


rH 

rH 

CO 

CT\ 


i—1 

i—i 

CO 

CD 


rH 

i—l 

CO 

LO 


rH 

i—1 

ro 

i—t 


rH 

i — 1 

'CM 

hT 


x —1 

i—1 

1 —i 

t" 


t —| 

x —l 

X —) 

O 1 


i—1 

O 

o 

LD 


[—1 

O 

VO 

O 

iJ 1 

t— 1 

o 

in 

r- 

7a6/e 2Z?. (coth 

x — 1 

o 

in 

CO 


EhEhEhEhEhEhE-^EhEhEhEhEhE - 1 i Eh EhH h h Eh H H E-1 E—f E— 1 E— 1 

■ **#*■•«■ ■ « • » * | « 4 c t * l i * # • # 





uouooouuuuouuoouuuuuouoou 


EH £h eh Eh H H Eh E-h Eh H 
HH^LhHHHHEhH 

HHHHHHHEhEhEh 


Eh Eh Eh Eh R 

^ H Eh Eh H 

H H E -1 E h Eh 

o O 0 O O 


Eh 

Eh 


Eh 

Eh 


H 

Eh 


H 

Eh 


Eh 

Eh 


Eh 

Eh 


Eh 

Eh 


Eh 

Eh 


Eh 

Eh 


EH 

Eh 


* 

» 













a 

U 

U 

U 

U 

a 

o 

a 

U 

■ 

U 

9 

9 

< 

rii 

< < 

< 

< 

< 

< 


C 

< 

<C 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

Eh 

■ 

H 

Eh E-i 


H 

Eh 

Eh 

Eh 

H 

EH 

Eh 

EH 

EH 

Eh 

Eh 

H 

H 

Eh 

Eh 

H 

H 

H 

Eh 

EH 


UUOUOOU0O0 ■ - 


uuuuuouaou- ■ * * ■ - ■ ■ ■ • * * * ■ • 

EEEEEHEEEE... 

.H E Ei E E.* <J 

0000000000000000000000000 

uouoouuuuoouutjuuuuuouuouu 


Eh 

H 

Eh 

Eh 

H 

H 

Eh 

H 

Eh 

Eh 






Eh 

H 

H 

Eh 

* 

H 

■ 

* 

* 

9 

* 

H 

U 

U 

a 

o 

O 

u 

u 

U 

u 

U 















* 

< 

< 

< 

c 

< 

< 

< 

< 

< 

< 

< 

<C 

< 

< 

<C 

< 


< 

< 

< 

< 

< 

c 

<c 

< 

» 

o 

o 

u 

o 

o 

u 

u 

u 

u 


U 

a 

u 

CJ 

u 

O 

U 

U 

a 

a 

a 

u 

o 

o 

o 

* 















O 

O 

o 

a 

o 

a 

o 

u 

0 

0 


o o o o o 


o ^ in h o o 

CO H rl H H O) (N rO CO C\ fSJ 

.Q £) J3 £1 X! .. m id u • ■ < * 

XlXjr'-COCnOlDC'V’Mt^CMCMtM CMCMrHCMmrHrO CO'^'M*^'^ 
voavoor-fLnLDiDcqpqpSp^pQQQQQpQQQQ 

SSSSSSSESlsfctif^ti&iEEEEHEEEHHH 

































































28 


Special Publications, Museum of Texas Tech University 





-C 


CM 

CO 

L0 

no 

• 

» 

* 

* 

H 

0 

0 

0 

0 

0 

0 

0 

0 

0 












CM 

CO 

CO 

rH 

■ 

























CM 

t — 1 

LO 

CO 

i 

























CM 

1 — 1 

ro 

OG 


























CM 

rH 

ro 

l -1 

























H 

CM 

rH 

CM 

CM 

H 

H 

E-* 

H 

H 

0 

0 

0 

0 

0 

01 

0 

0 

0 

0 

0 

0 

0^ 

0 

0 

0 

0 

0 

H 

0 

CM 

t— I 

n — \ 

CD 

■ 






















< 

< 

0 

CM 

ti — i 

i — i 

t—i 

< 

< 

C 

< 


< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

CM 

o 

CO 

CO 

# 






















< 

< 

< 

CM 

o 

no 

CO 


< 

< 


< 

<< 

< 


< 

< 


< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

CM 

o 

no 

co 























* 

* 

* 

CM 

o 

CO 

CM 

























0 

CM 

o 

CO 

O 






















« 

* 

* 

0 

CM 

o 

1—l 

DO 

• 

* 

* 

* 

0 

0 

0 

u 

0 

u 

0 

0 

0 

0 

< 

< 

< 


< 

< 

< 


< 

< 

< 

0 

(Ts 

CD 

O 

< 

>< 

< 

c 

< 

c 

< 

< 

< 

< 

< 

< 

< 

< 

< 

<< 

0 

CO 

0 

LO 


























i — ! 

CO 

CO 

CD 

u 

0 

o 

0 

0 

0 

0 

o 

o 

a 

0 

0 

u 

0 

0 

U 

0 

0 

0 

0 

0 

0 

U 

0 

U 

0 

CO 

0 

CM 

it 


















< 


< 


* 

A 

O 

0 

CO 

0 

O 















< 

< 

< 

< 

< 

< 

< 

< 

A 

rH 

CO 

CD 

1-1 























* 

A 

* 

x — J 

CO 

0 

GO 























* 

A 

0 

x — i 

CO 

CO 

r- 























* 

A 

< 

0 

CO 

CO 

no 

jjn 

H 

H 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

Eh 

0 

0 

0 

0 

H 

0 

0 

0 

0 

H 

CO 

l—i 

co 




0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

rH 

CO 

T-1 

ro 

























It 

rH 

00 

O 

0 


























rH 

0 

CO 

CD 

* 

























rH 

0 

0 

rH 


. 

» 

• 

O 

CD 

O 

0 

o 

0 

0 

O 

0 

0 










0 


T—1 

0 

o 

co 

O 

U 

U 

0 

* 










0 

0 

0 

0 

0 

0 

0 

0 

U 

t 

rH 

CD 

rH 

CM 



¥ 

* 

0 

0 

0 

0 

0 

0 

0 

[h 

0 

0 











< 

tH 

L0 

CO 

LO 


























rH 

no 

CO 

0 


























*—$ 

m 

no 

CM 

•* 


















< 

< 

< 

< 

< 


< 

rH 

LO 

ro 

O 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

1- \ 

m 

CM 

no 

H 

E-* 

H 


0 

0 

0 

Eh 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

H 

LO 

1-1 

00 

¥ 

























i—i 

0 

0 

0 


























rH 

0 

no 

GO 

i 

■ 

- 

* 

0 

0 

Ifni 

0 

0 

0 

0 

0 

0 

0 












tH 

0 

no 

0 

m 






















A 

* 

0 

i —\ 

0 

o 

00 

























* 

T - 1 

0 

o 

0 

























< 

rH 

CO 

GO 

0 

* 













4 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

1-1 

CO 

00 

o 

■ 














0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

A 

T-1 

CO 

CO 

0 

























A 

rH 

CO 

CO 

1—l 


























!—1 

CO 

CD 

CO 























0 

0 

< 

l—1 

CO 

no 

CO 

o 

0 

0 

0 

0 

O 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

T — 1 

CO 

0 

?- 1 

u 

U 

U 

0 

0 

0 

0 

0 

0 

0 

0 

0 

U 

0 

0 

0 

0 

U 

0 

0 

0 

0 

a 

0 

0 

rH 

CO 

ro 

GO 




* 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 











A 

rH 

CO 

CO 

CD 

1 * 

■ 

» 

■ 

0 

0 

0 

0 

0 

0 

0 

H 

0 

0 












*— 1 

CO 

co 

ro 


























0 

CM 

IT- 

GO 

























0 

rH 

CM 

0 

ro 


























rH 

CM 

0 

o 


■ 

- 

■ 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 












*— \ 

CM 

CD 

T-1 

1 

























rH 

CM 

rH 

CO 


























r—1 
rH 

l -1 

l -1 

CD 

CO 

00 

GO 

rfj 

< 

< 

C 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

C 

< 

< 


< 

< 

< 

< 

rH 

I-1 

CO 

CO 

























0 

i—f 

T — 1 

co 

no 

























rH 

1 — 1 

co 

<— 1 

■ 

• 

• 

* 

o 

0 

0 

0 

0 

0 

0 

u 

0 

0 












rH 

l —1 

CM 

0 

u 

u 

O 

0 

0 

0 

U 

0 

0 

0 

O 

0 

0 

0 

0 

0 

O 

0 

U 

0 

0 

0 

u 

0 

0 

rH 

T — 1 

<—\ 

0 

0 

0 

o 

0 






















t — 1 

T-1 

i—i 

0 



* 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 












i —\ 

O 

0 

in 

























■ 

rH 

O 

CD 

O 




§ 

0 

0 

0 

0 

U 

0 

0 

0 

0 

0 










A 

■ 

t—1 

o 

LO 

o 


























H 

o 

LO 

ro 




■ 










































o 

rH 

co 

0 

co 

ro 

x—1 

D3 




















l — 1 

0 

l — 1 

b—( 

rH 

\— 1 

t—1 

CM 

co 

CO 






o 

CM 

co 

0 





















00 


tHr-It—li—t 

! i—1<—i(—lrorOi<^<1rt!i<[I<tlt ; i<[l^( e il( 5: IlLr! 
NNNNQPQQPQQQQQKKKKRffiRffiWKH 


































































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


29 


03 

m 

in 

in 

CM 

ro 

oo 

rH 

CM 

i — l 

in 

oo 

CM 

i — 1 

00' 

00 

CM 

( — l 

oo 

rH 

CM 

i — 1 

OS] 

cm 

CM 

i — l 

rH 

VO 

CM 

i — l 

rH 

1 — 1 

CM 

o 

OH 

VO 

CM 

o 

in 

OH 

CM 

o 

m 

ro 

CM 

o 

00 

CM 

CM 

o 

oo 

o 

CM 

o 

1 — 1 

00 

t — { 

GH 

ID 

o 

T—t 

OH 


VD 

1—t 

CD 

oo 

VD 

1 — 1 

CO 

r 

OH 

<—1 

00 

r 

o 

1 — 1 

00 

ID 

l — 1 

^—1 

00 

0 

oh 

1 — 1 

00 

00 

r- 

1 — 1 

00 

00 

in 

1 — 1 

00 

t—1 

00 

1 —I 

00 

rH 

00 

1 — 1 

CO 

o 

f> 

i—i 

o 

CO 

VD 

T-1 

o 


1—1 

r—1 

\> 

o 

00 

rH 

VD 

rH' 

cm 

rH 

m 

00 

m 

rH 

LO 

00 


rH 

LO 

m 

OH 

rH 

m 

00 

r- 

rH 

in 

CM 

LiO 

i—1 

L0 

rH 

OH 

i —1 


r- 

r- 

i—1 


in 

CO 

i—1 


tn 

H-* 

i—1 


o 

CO 

i —l 

'Sp 

o 

r~ 

i—1 

oo 

OH 

r- 

i—1 

00 

OH 

o 

n—1 

00 

CO 


i—1 

00 

CO 

T—! 

<—1 

00 

VO 

00 

i—1 

00 

in 

00 

<—1 

00 

XP 

I 1 

<—1 

00 

00 

OH 

i—1 

00 

ro 

VD 

i—1 

00 

ro 

00 

i—1 

CM 

r 

oh 

i—1 

cs 

r 

ro 

i—1 

<N 

o 

o 

rH 

CM 

ID 

H 

rH 

CM 

1—i 

00 

rH 

f — 1 

ID 

00 

t— 4 

t —\ 

OO 

OH 

i—1 

X —S 

oo 

CO 

t— 4 

rH 

ro 

in 

rH 

!—1 

ro 

rH 

t— 4 

(—1 

OH 


r — 4 

s - f 

rH 

0 

rH 

1 — 1 

rH 


rH 

o 

r 

m 

r — 1 

o 

VD 

o 

t—1 

o 

in 

r 

rH 

o 

LO 

00 






■ 

-O 











0 

0 

0 

0 

0 

0 

0 

0 

4 








0 

0 

0 

0 

0 

H 

0 

0 

H 

Eh 

0 














Eh 

Eh 

H 

0 

0 

0 

0 

0 

0 

EH 

0 

0 

0 

0 

0 

0 

Eh 

Eh 

H 






0 

0 

0 

0 

0 

0 

0 

0 

< 

< 

<3 

< 

< 

< 

< 

< 

< 

< 

^3 

< 

< 

< 

< 

< 

< 

< 

<3 

< 

< 

< 

< 

< 

0 

0 

0 

0 

0 

0 

0 

0 




0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

CD 

' 

* 












Er 

Eh 

0 

Eh 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

0 

< 

< 

< 

< 


< 

rf3 

<3 

<c 

<3 

< 

< 

< 

rt3 

< 

<3 

u 

0 

0 

0 

0 

u 

0 

0 

0 

0 

0 

0 

u 

0 

0 

0 

0 

0 

0 















ooo. 

0 £-t 0 EH Eh 0 Eh 0 t-< H 0 H H H Eh H 

H0000H000000000H 


0 O O CD O 


< < 


* EH H H 0 0 * *. 


- Eh H H Eh H 
OOOO0O00 


o O 0 0 0 0 0 O 
H H H ^ H H B H 


0 0 0 




< 

< 

<3 

< 

< 

< 

< 

^3 

< 

<3 

<3 

< 

< 

< 

< 

< 

0 

0 

0 

0 

0 

0 

0 

0 

0 

CD 

0 

0 

0 

0 

0 

0 

0 

o 

* 

0 

0 

0 

0 

0 

u 

0 

0 

0 

0 

0 

u 

0 

0 

« 








0 

0 

0 

0 

0 

0 

o 

0 

0 

0 














* 




< 

<t3 

< 

<! 

^3 







i 

* 

* 


■ 0 0 Eh H 0 










0 

0 

0 

0 

0 

0 

0 

H 

< 

< 

*3 

■<3 

< 

< 

< 

<3 

< 

< 


<1 

<3 

■< 

< 

< 


* 



* 



* 

0 

CJ 

0 

o 

0 

0 

0 

0 

0 

0 

0 














o 

0 

0 

0 

0 

0 

0 

0 

CD 

0 

0 

o 

o 

0 

0 

0 








* 

0 

0 

0 

0 

0 

0 

0 

0 

• 

■ 

■ 

Eh 

Eh 

Eh 

Eh 

E-I 







* 

* 

* 

w 


o 

CM 














CO 

1—1 

1—1 



CM 

00 

Sp 









* 

- 

■ 

00 

OH 

rH 

(—1 

rH 

OH 

VD 

CM 

■=p 

in 

VD 

0 

i—i 

in 

in 

Lfi 


(<r 


<1 

0 

r 

in 

in 

in 

L0 

ID 

VD 

Eh 

EH 

EH 

£3 


s 



Pd 

Pi 

pi 

Pi 

Di 

Pi 

Pi 

Pi 

1—? 

[Zj 


w 

M 

H 

pa 

w 



<! 




<3 

rfl 

-5 

3 

3 

03 

PQ 

PQ 

PQ 

PQ 


s 



2 



s 


: 
























































30 


Special Publications, Museum of Texas Tech University 


Table 3 A. Summary of Population Aggregate Analysis (PA A) D-Loop diagnostic sites far Avahi species. Refer to Table!A. *No 


character or attribute is available for this fragment (A. betsileo was formerly referred to 

as Avahi species nova hi). 

Species 

Fragment Size (bp) 

PAA base pair location 

Avahi hunger type # 1 (Mantadia) 

562 

543 

Avahi laniger type #2 (Mananara-Nord) 

562 

* 

Avahi peyrierasi type #2 

562 

336, 548 

Avahi peyrierasi type #3 

562 

172, 194, 195,333, 502, 505 

Avahi meridionalis ramanantsoavana 

562 

158, 194. 199, 525 

Avahi meridionalis meridionalis 

562 

16, 64, 159. 422, 506 

Avahi betsileo 

562 

20, 227, 277, 309, 334, 348, 521 

Avahi unicolor 

563 

106, 288, 313, 396,397.401 

Avahi cleesei 

563 

64, 112, 275, 276, 279,287, 300, 302. 332 

Avahi occidenla}is 

563 

295, 296,314, 499 


Table 3B, Summary of Population Aggregate Analysis (PA A) PAST diagnostic sites far Avahi species. Refer to Table 2 B. 

Fragment 

Species PAA base pair location 

Size (bp) 


A vah 11 !an iger type # 1 (M antadia) 23 64 

Avahi Umiger type #2 (Mananara-Nord) 2364 
Avahi peyrierasi type #2 2364 

A vah i peyrierasi type #3 2364 

Avahi me r id to nalis ran umantsoa vana 2364 

Avahi meridionalis meridionalis 2364 

A vahi betsileo 2364 

Avahi unicolor 2364 

Avahi cleesei 2364 

A vahi 0 cci dental is 2364 


671.957. 1117, 1708 
576.835,1390,1397, 1708, 1870 

54, 108,246,701,962. 1408. 1584, 1861, 1946, 2096, 2153, 1052 

14, 75. 155,344, 572, 590,698,945, 1124.1139,1341, 1353, 1525, 1537, 1818,1835, 1886. 

1960,2059,2111,2123 

29, 279, 938, 940,972, 985,1261, 1273, 1381,1384,1407,1807 

85, 289, 29 L 339, 708. 847, 935, 952, 958, 1060. ] 114, 1131, 1270, 1336, 1339, 1612. 1771, 
2013,2355 

108,336, 838,920, 1052, 1053,1363,1813,1837 

6. 93, 114, 133, 501,636. 916, 1052, 1135, 1279. 1454, 1849, 1872,2032,2116,2131 

8, 118,213, 258, 522, 704,785, 928, 1057, 1213, 1273, 1552, 1585. 1786 

47, 111. 121, 500, 540, 665. 764, 783, 826, 1075, 1138, 1168, 1333, 1477, 1519, 1525, 2053, 
2059, 2116, 2138, 233! 


















Andriantompohavana et al.— Woolly Lemurs of Madagascar 


31 



Figure 15. Avahi laniger , eastern woolly lemur, at Mantadia National Park. Photo by Edward E. Louis, Jr. 













32 


Special Publications, Museum of Texas Tech University 



Figure 16. Avahipeyrierasi Type #2, Peyrieras’ woolly lemur (Type #2), at Ranomafana National Park (Am- 
batolahy Dimy). Photo by Edward E. Louis, Jr. 

















Andriantompohavana et al.— Woolly Lemurs of Madagascar 


33 



Figure 17. Avahipeyrierasi Type #3, Peyrieras’ woolly lemur (Type #3), at Ranomafana National Park (Ambatolahy 
Dimy). Photo by Edward E. Louis, Jr. 








34 


Special Publications, Museum of Texas Tech University 


Table 4A. Genetic distance matrix for D-Loop sequence data for Avahi species. The numbers represent the following Avahi species: 
[I] Avahi pcvrierasi type 42; / 2] Avahi peyricrasi type 43: [3] A vahi ramanantsoavana; [4] Avahi betsileo; [5] Avahi meridional is; 
[6] Avahi lanigen p] Avahi unicolor; [8] Avahi cleesei: and [9] Avahi occidental is. Genetic distance based on absolute differences 
is displayed above the diagonal, and genetic distance based as a percentage is displayed below (he diagonal (A. hetsileo was formerly 



1 

2 

J 

4 

5 

6 

7 

8 

9 

1 


31 

29 

28 

00 

42 

62 

65 

59 

2 

5.28+0.95 


21 

19 

29 

43 

50 

56 

47 

0 

4.75*0.87 

3.67±0.80 


24 

21 

42 

56 

59 

51 

4 

4,75*0.91 

3.43*0.77 

4.21*0.85 


28 

42 

58 

62 

53 

5 

5.56=0.98 

5.18*0.97 

3.51*0.75 

5.04*0.96 


43 

56 

58 

51 

6 

5.31 ±0.86 

5.64*0.93 

5.85*0.92 

5.50*0.9! 

5,99*0.97 


58 

63 

56 

7 

11.63*1 43 

9.47*1.26 

10.67*1.30 

11.30*1,43 

10.83*1,42 

9,61*1,23 


24 

15 

8 

12,28*1.46 

10.52*1.39 

11,22+1.42 

12.07*1.52 

11.13*1 43 

10.78*1.36 

4.17*0,85 


22 

9 

l l.03±L36 

8.84*1.22 

9.62*1.28 

10.24*1.35 

9.75*1.34 

9.04*1.15 

2.76*0.70 

3.86*0.80 


Table 4B. Genetic distance matrix for PAST sequence data for Avahi species. The numbers represent the following Avahi species: 

[1] Avahi peyrierasi type 42; [2] Avahi peyricrasi type 43; [3] Avahi ramanantsoavana; [4] Avahi betsileo; [5] Avahi meridional is; 
[6] Avahi lanigen [7] Avahi unicolor; [8] Avahi cleesei; and [9] Avahi oecidcntalis. Genetic distance based on absolute differences 
is displayed above the diagonal, and genetic distance based as a percentage is displayed below the diagonal (A. betsileo was formerly 



1 

2 

■Tl 

4 

5 

6 

7 

8 

9 

1 


75 

68 

68 

74 

105 

238 

244 

247 

2 

3.21*0.36 


77 

31 

83 

103 

225 

236 

242 

■N 

_} 

2.78=0.36 

3.24*0,41 


69 

52 

107 

239 

241. 

249 

4 

2,92*0,37 

1,33*0.23 

2.88*0.39 


74 

99 

220 

229 

235 

5 

3,14+0,37 

3.58+0.41 

2.09*0.32 

3.20=0,41 


110 

241 

246 

251 

6 

3,78=0,37 

3.66=0.35 

3,75*0.36 

3,45*0,37 

3.99*0.37 


246 

247 

251 

7 

11.06*0.68 

10,46*0.68 

11.06=0.69 

10 ,20*0,66 

11,29*0.71 

10,69=0.65 


67 

66 

8 

11.28*0.72 

10,96*0,71 

11.08*0.66 

1 0.59*0.68 

11,47*0.72 

10,69=0.69 

2.86*0,37 


64 

9 

11.44*0.69 

11,25*0,69 

11.48=0.63 

10.88*0.67 

11,72*0.68 

10,88*0,65 

2.83*0,32 

2.69*0.33 












Andriantompohavana et al.— Woolly Lemurs of Madagascar 


35 


nova #1 to A. peyrierasi #3), respectively. The 
highest and lowest average uncorrected pairwise 
distances and absolute genetic differences for the 
PAST sequence alignment between the eastern 
woolly lemurs range from 3.99 to 1.33 and 110 to 
31 (A. m. meridionalis to A. laniger and A. species 
nova #1 to A. peyrierasi #3), respectively. The 
highest and lowest average uncorrected pairwise 
distances and absolute genetic differences for the 
D-Loop sequence alignment between the western 
woolly lemurs range from 4.17 to 2.76 and 24 to 
15 (A. unicolor to A. cleesei and A. unicolor to 
A. Occidentalis) , respectively. The highest and 
lowest average uncorrected pairwise distances 
and absolute genetic differences for the PAST 
sequence alignment between the western woolly 
lemurs range from 2.86 to 2.69 and 67 to 64 (A. 
unicolor to A. cleesei and A, unicolor to A. oc- 
cidentalis), respectively. 


The Bayesian analyses are presented in Figs. 
18-19. All analyses differentiate six recognized 
Avahi species, two types of A. peyrierasi and the 
newly described species. The minimum spanning 
network presents diagrammatically the speciation 
among the six recognized woolly lemurs (Fig. 22). 
There is high bootstrap support for the ML analy¬ 
sis with respect to the topology among the genera 
and species (Figs. 18-19). The phylogenetic trees 
reconstructed through the various inferences and 
models produced identical topologies with the 
exception of the sister relationships between A. 
cleesei and A. occidental is or A. unicolor. Based 
on the sequence fragment utilized to reconstruct 
the tree; the D-Loop sequence fragment aligned A. 
cleesei with A. unicolor, but the PAST sequence 
fragment aligned A. cleesei with A. occidentalis 
(D-Loop versus PAST fragments; Figs. 9-12). 


Discussion 


Notwithstanding what previously was consid¬ 
ered superficially inconspicuous phenotypic charac¬ 
ters, the woolly lemurs present subtle but definable 
morphological and phenotypic traits (Figs. 2-7,15-17, 
21-24; Table 1; Appendix Id). Milne-Edwards and 
Grandidier (1875a, b) noticed Avahi in the north¬ 
ern Ampasindava area in the late the 19th century 
and remarked that this Avahi from northwest was 
different and smaller than other A. laniger but did 
not recognize the significance of the differentiation 
at that time. The trend shown by the grouping of 
some morphological traits and the tendency towards 
lighter is evident in the data analyses (Tables 1A 
and IB). The tendency towards greater variation is 
expressed in the confidence intervals and the range 
of trait means observed more often among the eastern 
woolly lemur rather than in the western woolly lemurs 
demonstrated in Appendix Id. This should not be so 
surprising given the magnitude of variation in the 
mitochondrial haplotypes detected in the eastern as 
compared to the western species. Furthermore, the 
molecular sequence data submitted for the woolly 


lemurs corroborates the '‘global” phylogeographic 
distribution of eastern and western lemur clades 
(Figs. 8-14; Louis et al. 2006a, 2006b; Zaramody et 
al. 2006). 

The D-Loop sequence presented was gener¬ 
ated for only a single representative for each recog¬ 
nized species of the family Indriidae, specifically 
the genus Propit he cits (data were generated for two 
individual samples of Indri indri ; Figs. 8-10). The 
molecular sequence data offers a tentative glance at 
the relationships of this group to the other genera 
and species of lemurs. The relatively low bootstrap 
support (56%) between Indri indri and the genera 
Avahi and Propitheciis should be further investi¬ 
gated, utilizing sequence data representing not only 
a coding region (for instance, PAST fragment or 
cytochrome B subunit gene), but also nuclear DNA 
sequence data and the addition of multiple samples 
from multiple subpopulations and/or localities 
that are representative of the recognized species’ 
distributions (Fig. 8). 


(text continued on page 43) 



36 


Special Publications, Museum of Texas Tech University 



U 


■a—/A 


« 










.*i Mb! " U, 'TjerfmM mrritifmmi 

UMKSwMtwiihi 
KAN WlTTH 1 .■■■'hTI» m&W 

I \\?l I . ... . i Ilrliyini 

RANCH J£Wili' iM.it.'- 
fiAftfl* * "i ifttpainmtr x. iHrtdSn'hJlfT 
krWfW! I 


ra-n«m 


iV..riii'r*<lir L ' jpiATU 


RAscjijsi 
RAMi’S ’! 

AVM *• l'j.|-.'.'r l rTr^ I Til *.Y' I .'in’ 11" 1 

j^fL4 


■MIZAJJI 


I'.vuri m.i.. 



- RAM UUj J fin , t| r.'ii .; 111 |Vi u nj 
■JIARI-I ^Vignmin iu t upuIuTiaa 

-ANAlJ'OjWnprtAi't n> > . 

ilAlllJ fhxh ■■*• ■) 

-IK4L2 tn ittpnVrii 

-15 i,R4 2 i ,l .!-ri«'i'r l T li^i lulTiV WiVi 
~ BI:MA4- Pny fa fcwcitf tffatan *Epr4i7d 
-M\M 7 /Kn-.fn fhm u* *T r mxjw.irtvi 
-MC:■ ftuK/V.^v 'Wvmt r*m tiuw 


ry[K -2 


mi r.i,r,jii..i!,'Mr.vi.jm\i 


ft! ItTffiA'rtHIltit 


jww^mMjpc m3 


.-|r.<l.V a StpcciffS I|i 11 -cJ 1 1 


TAD4,* 
TAlM M 
MIZaB 

aiai 1 

MIZA14 
XARA4.I 
X i Fl A I U 
NAKA4-2 
NAHA-1 IJ 
NAKA4j} 

S‘ Aft A4 11 
VAEA4.il 
V A FLA 4 17 
NARA-I.IS 
AM I V.}' 

AN I i 4 
AM 5 i: 
AM 5 I !:■ 

nr mas 

Hi I M.V) 

III MAI? 
BEMAIJ 


.-fnrAr 


bwi k'oifw 


A'l itfu fltV’,11 


MAI 
MAR4ifi 
MAR54 

M\Ri£U AVilkI ixy !iirn/il)ii 

MARK 

M.AKJ55 

MAR 


Figure 18. Bayesian majority rule maximum likelihood analysis cladogram derived from the D-loop DNA sequence 
data from the 77 Avahi individuals with 26 out-group taxa. Values above branches indicate support of bootstrap pseu- 
doreplicates with values greater than 50% reported. 
















































































































































































































Andriantompohavana et al.— Woolly Lemurs of Madagascar 


37 


I'M 






Majiiriiy rule 


*9 






A/— 


VA 




■.■I 



99 . 


_!»_J-- 



V* 



99 . ,_ 




-=—c 





lilt 




■Ti* 


*1 


94 


9* 


I H> 


49 


«■ 


t +M 


49 




T>- 


9C 


49 


99 


109 


W 


JHh 


K4 


41 


Lihi 




TJ 


■W 


IIHI 


JlEL 


IH 


>lXl 


71 


IH 


IDG 


94 


49 






JtiL 


J3L 


AM&L7- MicrtrCvbiti MPpl&bentfa 

RAN0250- Mknit^fytis rujux 
(JAR*- 1 —- Chemigatcmt meatus 
RANQ229-- Chcirogafeux major 
asaO—-- Lepiitww airtofFmewts 


k BilUlU 

— ftufkitc-untr g. gri.i 
S jiapatemur g, occidmlatis 


' ■ Jtapatvamr g. giis^a i 

CARP 
'ANALZ.23? 

RANtHS. Evlctmrfafvti* ritfiis 

1 RAN2 Vtrrvt'hi Yitrttfgalu vfirh’gvlf* 

RAN03J2 '" rntfAthwiu- - 
■ mprwc-. Rmittihccua wrremai 



99 

—* 






•w 









Asufii pQ'riemtt lypc 41 


Awthi m. ritfHiinanisoavQwi 


■ RAN067 
“ RANDIW 

- HAHOSAl 

- RAKO320 

- y.wl i-s 
-IAVMS 
-■ F AN-’ IV 

- I AN2.21 
-* IAN2.2U 

- r.Alil 

- TAD2 

- DAlii 

^TAOl^ 

- TaIIJ? 
-tajdi.io 
-MIZA1Q 
’MlZAii 
-MIZaM 
-* jALJlt 
■* IAI14 J 
-Taijj.h 

- IAIJ4.V 

- M3IAI3 
-NARA4 1 

- NAKA4 2 

- VaR AJ 1 1 

- NAKA4 2i 

- N \KA I " 
-NAKA4 hi 
-NARA4 li 
-NAHA 4 17 
^NARA4 IX 
_ NAHA4, *1 

J A NTA.fi 

- avtj.LS 

-BEJrlUi 

-IIFMA'J 

- BEMA12 

- BE MAI 3 
-BLMA14 

■ MAKS' 

, MAR4* 

- MARtt 

MAR'S 
, MAR64) 

■ MAR 54 
MARSrv 

'MAR* I 


jIiwAi ffl. meridional^ 


Avahi pcyrk'msi lypc 


Avahi sjwcics nmu #1 


Avahi Iwrigpr 


Avahi tmicaiar 

Avahi cltesei 

Ai-abi (A X'idettiaiit 


Figure 19. Bayesian majority rule maximum likelihood analysis cladogram derived from the PAST DNA sequence 
data from the 77 Avahi individuals with 19 out-group taxa. Values above branches indicate support of bootstrap pseu- 
doreplicates with values greater than 50% reported. 




































































































































































































38 


Special Publications, Museum of Texas Tech University 




2 

< 

L- 

1 


o 

s. 

< 

C4 

;l 

a. 

? 

1 m r 

kl 

£ 

V 


r- 

t _r 

< 

" 

■tt; 

D 

=_ 

£ 


i § 

5 < 


o 


L J a £ 


^ t 


V ti 


=r -*3 

5 “1 


c 


■s -Jf' 
5l it ft 


< 

£ 

< 

z; 

< 

£4 

5 s 
s < 

T & 

^ -Hi, 

s< > 


5" > 

£ S U 5 

■§ ^ £ is 

5 & S] ft 


< : 

§ J 

£ ! 


u 






T N T 


E 

«a 




9 


-f )< 

flB 



v\ 

t£ 

< 

5 



Figure 20. Minimum spanning network of Avahi haplotypes calculated using Arlequin Version 2 and Network Version 4.11. Identification numbers denote haplotypes cor¬ 
responding to Appendix II The minimum number of mutational steps separating matriarchal lines is indicated. Nucleotide substitutions are indicated by dashes. The number 
of nucleotide differences in their connecting lines (more than 10) is indicated when they are more than one. Missing intermediates are indicated by gray circles. The size of 
the circles approximates the number of individuals with matching haplotypes (circles without any number represent one individual). 













Andriantompohavana et al.— Woolly Lemurs of Madagascar 


39 



Figure 21. Avahi meridionalis, southern woolly lemur, at Andohahela National Park (Manangotry). Photo 
by Edward E. Louis, Jr. 


40 


Special Publications, Museum of Texas Tech University 



Figure 22. Avahi ramanantsoavana, Ramanantsoavana’s woolly lemur, at Manombo Special Reserve. Photo by 
Richard Randriamampionona. 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


41 



Figure 23. Avahi betsilio, Betsilio woolly lemur, at Fandriana District (Bemosary Classified Forest). A. 
betsilio was formerly referred to as Avahi species nova# 1. Photo by John R. Zaonarivelo. 






42 


Special Publications, Museum of Texas Tech University 



Figure 24. Avahi betsilio, Betsilio woolly lemur, at Fandriana District (Bemosary Classified Forest). A. 
betsilio was formerly referred to as Avahi species nova #1. Photo by John R. Zaonarivelo. 









Andriantompohavana et al.— Woolly Lemurs of Madagascar 


43 


A comprehensive dataset that includes repre¬ 
sentatives from multiple populations and sequence 
fragments for all recognized genera and species will 
be required to conclusively resolve the taxonomic 
relationships between the family Indriidae and other 
genera, but this data does offer corroborative evidence 
for establishing species versus subspecies status for 
regional populations of the genus Availi based on the 
phylogenetic species concept (Cracraft 1983). For in¬ 
stance, Zaramody et al. (2006) suggested that the status 
of A cleesei was questionable based on a relatively low 
genetic distance between A. cleesei and A. occidenta¬ 
ils. By evaluating the uncorrected genetic distance, 
morphological, phenotypic, and pairwise aggregate 
analysis data, along with the inclusion of the third rec¬ 
ognized western Avahi , A. unicolor , we conclude that 
the parameters generated with the multiple data sets 
are analogous to those established with other species, 
including comparisons within the genera Propithecus 
and Lepilemur (Figs. 8-14; Tables 1-4; Appendix Id; 
Mayor et al. 2004; Thalmann and Geissmami 2005, 
2006; Andriantompohavana et al. 2006; Louis et al. 
2006a, 2006b). For example, there exist significant 
differences within the cytogenetic, phenotypic, and 
morphological data among sifaka species which con¬ 
sequently led to full species status for seven sifakas of 
the genus Propithecus (Mayor et al. 2004; Mittermeier 
et al. 2006). Despite the elevation to full species status 
for the sifakas, the genetic distance based on D-Loop 
sequence data between Propithecus tattersal/i and P. 
coquereli or P. edwardsi and P. diadema is relatively 
modest (1.79 and 1.96, respectively; Mayor et al. 2004). 
The minimal genetic distance between individual sifaka 
species, however, can establish supportive evidence in 
favor of the legitimacy of A. cleesei since the genetic 
distance between each pair of sifaka mentioned previ¬ 
ously is less than estimated between A. cleesei and A. 
occiclentalis (3.86) and/or A. unicolor (4.17; Mayor et 
al. 2004). 

Despite several citations which identify type 
locality of Avahi laniger in the Retanimena country, An- 
tongil Bay. Maroantsetra, the type locality of A. laniger 
remains unknown or uncertain (Jenkins 1987; Groves 
2001; Zaramody et al. 2006). Nonetheless, based on 
phenotypic and molecular data (PAST fragment only), 
two types of A. laniger from the extreme ends of its 
range are evident within these data (Figs. 1,4, and 15; 
Tables 2-4; Mantadia and Mananara-Nord National 


Parks). Further research, including comprehensive 
samples and data generation, will be needed, however, 
to conclusively resolve the taxonomic relationships of 
the woolly lemurs between the Mangoro/Onive Rivers 
and Anjanaharibe-Sud Special Reserve. 

The data also established two types of A. peyri- 
erasi (Figs. 8-14, 16-17; Tables 1-4). In forest frag¬ 
ments south and north of Ranomafana National Park 
(Tolongoina Classified Forest; Zaramody et al. 2006), 
unpublished data reveal that both types of A. peyriercisi 
are found within the same habitat (within Vohiparara, 
Ambatolahy Dimy, and Talatakely, all subpopulations 
within Ranomafana National Park). However, no be¬ 
havioral or hierarchal data exists within a population 
or family group, so further research (mitochondrial 
DNA sequence and genoty pe data (pedigree analysis) 
combined w ith long term behavioral observations) is 
required to establish the relationships between these 
two types of sympatric Avahi. Furthermore, we suggest 
that the two subspecies, A. meridional is meridionalis 
and A. m. ramcmantsoavana , described by Zaramody 
et al. (2006), should be elevated to full species because 
the molecular, phenotypic, and morphological data is 
equivalent, if not more conclusive, to the other previ¬ 
ously recognized woolly lemurs (Figs. 8-14, 18-22; 
Tables 1-4). 

In this paper, the current Avahi taxonomy w as ex¬ 
amined according to the Phylogenetic Species Concept 
(PSC) sensu Wheeler and Platnick et al. (2000), Mayor 
et al. (2004), and Louis et al. (2006a, 2006b). The 
diagnostic characters or attributes define evolutionary 
significant units (ESUs). Several authors suggest that 
ESUs are equivalent to species as determined through 
the Phylogenetic Species Concept (Cracraft 1983; 
Barrow'dough and Flesness 1996; Amato et al. 1998). 
The constant addition of samples to the PAA data set 
will continue to test the distinction of these characters. 
The identification of a new species in the following 
description establishes the essential need for extensive 
as well as detailed sample collections across Mada¬ 
gascar to determine geographic ranges and taxonomic 
status for all of the woolly lemurs. This research is 
especially needed on opposite aspects of all rivers (for 
example, north of the Mangoro River to Anjanaharibe- 
Sud Special Reserve). Due to the inability to maintain 
woolly lemurs as long-term live vouchers in captivity, 
whole blood, morphometric, and e-voucher photos will 



44 


Special Publications, Museum of Texas Tech University 


serve as the type series for the newly described species, 
Avahi species nova #1, described below. In this case, 
an attempt was also made to identify existing museum 
specimens to represent the type series, but a museum 
specimen has not been identified from this specific 
region which could serve as the holotype. 

Avahi betsileo , New Species 

Type Series. —Whole blood for FAN2.14 (TK 
125757), adult male; FAN2.15 (TK 125758), adult 
female; and FAN2.20 (TK 125759), adult male; are 
stored and curated at the Museum of Texas Tech 
University. Individual measurements, e-voucher 
photos, and collection data are given in Avahi Field 
Data Appendix la. FAN2.14, FAN2.15, and FAN2.20 
were collected by Richard Randriamampionona, Jean 
C. Randriamanana, Gerard Nalanirina, Razafindraibe 
Jean, Rambinintsoa Andriantompohavana, and John 
R. Zaonariveloon 13 July 2002, 13 July 2002, and 15 
July 2002, respectively. 

Type Locality. —Madagascar, Province de 
Fianarantsoa, Region AmoronT Mania, District of 
Fandriana, Bemosary Classified Forest, 20°20'60.1 "S, 
47°33'36.1 "E, and south of Mangoro River. 

Description. —When A. betsileo is compared 
to other southeastern woolly lemurs, Avahi betsileo 
(1.05 kg) is approximately the same size as A. pey- 
rierasi ty pe #2 (0.86 kg) and A. meridionalis (1.06 
kg), but slightly larger than A. peyrierasi type #3 
(0.98 kg) and A. ramanantsoavana (0.98 kg; Table 
1). Phenotypically, A. betsileo differs significantly 
from other eastern woolly lemurs with a pelage that 
is primarily light reddish-brown on the body and on 
the dorsal surface of the extremities (Figs. 23-24). 
A. betsileo has a distinct facial mask with grayish 
pelage under the mandible and the ventral surface of 
the extremities. A. betsileo has diffuse cream colored 
eyebrow markings and a thicker pelage on the head 
which gives a more round or oval-like appearance of 
the head that distinguishes it from the other eastern 
woolly lemurs. The venter is dark gray towards the 
midline and diffuses to a light gray ventrolaterally. 
The tail is primarily reddish brown, darker on the 
dorsal surface than the ventral portion which is a 
lighter reddish blonde. 


Diagnosis. —In the D-loop and PAST sequence 
fragments, A. betsileo differs from the closest rela¬ 
tives, A. peyrierasi ty pe 2, and A. peyrierasi type 3 by 
4.75%±0.9l% (28 informative sites) - 2.92%±0.37% 
(68 informative sites) and 3.43%±0.77% (19 informa¬ 
tive sites)- 1.33%±0.23%(31 informative sites ), respec¬ 
tively. In the D-loop and PAST sequence fragments, 
A. betsileo differs from the closest species relative to 
geographic distance, A. laniger, by 5.50%±0.91% (42 
informative sites) and 3.45%±0.37% (99 informative 
sites), respectively. 

Distribution. — A. betsileo is currently known 
in the Bemosary Classified forest (Fandriana) and the 
regional distribution will be tentatively set from south 
of the Mangoro River and north of the Mananjary River, 
until its distribution can be confirmed. 

Comparisons and Remarks.—Avahi betsileo 
is approximately the same size as A. peyrierasi type 
#2 and A. peyrierasi type #3, larger than A. raman¬ 
antsoavana , and smaller than A. laniger (Table 1). 
Although A. betsileo is not genetically that different 
from both types of A. peyrierasi based on absolute and 
percentage differences, the phenotypic differences are 
noticeable (Figs. 23-24). Additional survey work is 
required to determine the southern and northern range 
of A. betsileo and the northern extent of A. peyrierasi 
type #2 and #3. 

Etymology. —The name betsileo is proposed for 
this species and is derived from the Malagasy tribe from 
the Fandriana region. 

Vernacular Name. —Betsileo woolly lemur. 

By applying the phylogeographic studies by 
Thalmann and Geissmann (2000) and Pastorini et al. 
(2003), geographic barriers can be defined that affect 
multiple taxa ultimately of both flora and fauna. By 
establishing and prioritizing these phylogeographic 
regions, conservation management decisions can be 
implemented that will support the preservation of bio¬ 
diversity within these defined regions. These areas of 
discrete or unique biodiversity show that the all major 
rivers are significant factors or barriers and augment 
the processes of speciation (Fig. 25). The emerging 
data display a distribution of unique biodiversity 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


45 



Mahajamba 

Mariarano— 

Belsiboka- 


Mangoky 


Mabavavy Noad- 

Antafondro* 

Sambi ratio- 


Irudo 
Loky 


0_J00 

km 


Maevaraa® 

Sofia 


Mahavavy Sud 
Mamngoza 


Manambalio 
Manana bole 

Tsingy dc 
Bemaraha 

Tsiribihina 
Morondavu 


Fihcrcnana 

Onilahy 


tJeifiarivO 

Anjanaharibe-Sud 

Antainambalana 


Mananara-Nord 


Masoala 


Maningory 

Onibc 


Mantadia 
Maromizaha 

Mangoro 

Fandriana 

Namorona 

Ranomafana 


Lima 


Faraony 

Manampatntna 

Manombo 

Manama ra 

Andohahda 
(Manangotry) 

Mandmrc 


^ Avaki betsifeo 

Avaki peyrieraxi Type ^2 
• ^ Avakipeyrierasi Type 
^ Avahi ramanantsativana 
(P Avahi meridionalis 
■ | Avaki ianlger 
Avaki uirii otar 
A vahi cieesgi 
Avaki tii t itfcrtfaib 


Figure 25. Distribution map of the woolly lemurs of Madagascar - Revised distribution of the woolly lemurs. The letter “A” 
represents the location of Ankarana Special Reserve. The letter “B” represents the location of Kalambatritra Special Reserve. 

















46 


Special Publications, Museum of Texas Tech University 


framing the topology between all rivers (Andrian- 
tompohavana et al. 2006; Louis et al. 2006a, 2006b; 
Rioux Paquette et al. 2006). This relationship be¬ 
tween the rivers and biodiversity transcends taxa 
and is quite remarkable and consistent (Louis et al. 
2006b). As discrete species from different genera 
are being described, their individual distributions 
can be overlaid, resulting in river bound “pockets” of 
unique biodiversity (Cover Figure; unique woolly and 
sportive lemurs forming paired units of distinct biodi¬ 
versity). The persistent and rapid loss of habitat and 
the resulting fragmentation of panmictic populations 
have compelled wildlife and conservation agencies to 
take protective action according to existing guidelines 
and information with the ultimate goal of prioritiz¬ 


ing species and/or sites. The explosive rate of the 
deforestation in Madagascar, however, has eliminated 
many of the available options (Green and Sussman 
1990). Because haplotypes can be unique to each 
population, simply preserving one population will not 
necessarily maintain species-wide genetic variability 
(Pope 1996; Louis et al. 2006b). Despite the recent 
revisions of the woolly lemurs, isolated fragments or 
forests that represent unique habitat in Madagascar, 
such as Kalambatritra and Ankarana Special Reserves 
and Masoala National Park, could potentially contain 
particular or distinctive Avahi species, so additional 
comprehensive field work and laboratory work needs 
to be completed (Cover Figure). 


Acknowledgments 


This manuscript was supported in part by a grant 
from the Committee for Research and Exploration of 
the National Geographic Society (6613.99), Primate 
Action Grant, and Margot Marsh Foundation Grant. 
This project would not have been possible without the 
support of the staff, guides, and drivers of the Institute 
for Conservation of Tropical Environments, Mada¬ 
gascar (1CTE-M1CET), as well as the Association 
Nationale pour la Gestion des Aires Protegees (AN- 
GAP), Parc Botanique etZoologique de Tsimbazaza, 
U. S. Fish & Wildlife, University of Antananarivo’s 
Anthropology Department, and the Ministere des 


Eaux et Forets of Madagascar. We acknowledge the 
generosity of Bill and Berniece Grewcock for their 
long-term support and commitment, which gave the 
CCR its direction and identity. Furthermore, we 
would like to acknowledge that this research would 
not be possible without the incredible support by the 
Ahmanson Foundation, the Theodore F. and Claire M. 
Hubbard Family Foundation, and the James Family. 
We would also like to acknowledge the computer 
specialists, Patrick Lill, Dana Gilbertson, and Ron 
Kipple, for creating the web page and documents. 


Literature Cited 


Amato, G., J Gatesy, and P. Brazaitis. 1998. PCR 
assays of variable nucleotide sites for identifi¬ 
cation of conservation units: an example from 
Caiman. Pp. 177-190 in Molecular approaches 
to ecology and evolution (R. DeSalle and B. 
Schierwater, eds ). Birkhauser Verlag, Basel, 
Switzerland. 

Andriaholinirina, N., J.-L. Fausser, C Roos, C. Raba- 
rivola, I Ravarimanana, D. Zinner, U. Thal- 
mann, J. U. Ganzhorn, B. Meier, R. Hilgartner, 
L. Walter, A. Zaramody, C. Langer, T. Hahn, E. 
Zimmermann, U, Radespiel, M. Craul, J. Tomiuk, 
I. Tattersall., and Y. Rumpler. 2006. Molecular 
phylogeny and taxonomic revision of the sportive 
lemurs ( Lepilemur, Primates). BioMed Central 
Evolutionary 6:1-13. 


Andriantompohavana, R , J. R. Zaonarivelo, S. E. Eng- 
berg, R. Randriamampionona, S. M. McGuire, 
G. D. Shore, R. Rakotonomenjanahary, R. A. 
Brenneman, and E. E. Louis, Jr. 2006. The 
mouse lemurs of northwestern Madagascar with 
a description of a new species at Lokobe Special 
Reserve. Occasional Papers of the Museum, 
Texas Tech University 259:1-23. 

Arevalo, E., S. K., Davis, and F W. Sites. 1994. 
Mitochondrial DNA sequence divergence and 
phylogenetic relationships among eight chromo¬ 
some races of Sce/oropus grammicus complex 
(Phrynosomatidae) in central Mexico. Systematic 
Biology 43:387- 418. 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


47 


Baker, C. S., A. Perry, J. L. Bannister, M. T. Weinrich. R. B. Ab- 
emethy, J. Calambokidis, R. H. Lien, J. U. Lambersen, O. 
Ramirez. P Vasquez. J. Clapham, A. Ailing, S. J. O'Brien, 
and S. R. Palumbi. 1993. Abundant mitochondrial DNA 
variation and world-wide population structure in hump¬ 
back whales. Proceedings of the National Academy of 
Science 90:8239-8243. 

Bandelt, H.-J , P. Forster, and A. Rohl. 1999. Median-joining 
networks for inferring intraspecific phylogenies. Mo¬ 
lecular Biology and Evolution 16:37-48. 

Barrowclough, G F,, and N. R Flesness. 1996. Species, subspe¬ 
cies, and races: the problem of units of management in 
conservation. Pp. 247-254 in Wild mammals in captivity 
(G. G. Kleiman. M. Allen, and FI. Harris, eds.). University 
of Chicago Press, Chicago, Illinois. 

Cracraft, J. 1983. Species concepts and speciation analysis. Pp. 
159-187 in Current ornithology, Vol. 1 (R. F. Johnston, 
ed.). Plenum Press, New York, New York. 

Davis, J. I., and K. C. Nixon. 1992. Populations, genetic 
variation, and the delimitation of phylogenetic species. 
Systematic Biology 41:421-435. 

Ezard, T. H. G., and J. M. J. Travis. 2006. The impact of habitat 
loss and fragmentation on genetic drift and fixation time. 
Oikos 114:367-375. 

Forster, P, A. Torroni, C. Renfrew, and A. Rohl. 2001. Phy¬ 
logenetic star contraction applied to Asian and Papuan 
mtDNA evolution. Molecular Biology and Evolution 
18:1864-1881. 

Gonzales, S., J. E. Maldonado, and J. A. Leonard. 1998. Con¬ 
servation genetics of theendangered pampas deer {Ozoto- 
ceros bezoarticus), Molecular Ecology 7:47-57. 

Green, G. M., and R. W. Sussman. 1990. Deforestation history 
of the eastern rain forests of Madagascar from satellite 
images. Science 248:212-215. 

Groves, C. P. 2000. The genus Cheirogaleus: unrecognized 
biodiversity in dwarf lemurs. International Journal of 
Pnmatology 21:943-961. 

Groves, C. P. 2001. Primate taxonomy. Smithsonian Institu¬ 
tion, Washington, D.C. 

Huelsenbeck, J. P, and F. Ronquist. 2001. MRBAYES: Bayes¬ 
ian inference of phylogeny. Bio informatics 17:754-755. 

IUCN. 2004. IUCN Red List OF Threatened Species: www. 
lucnredlist.oru. Downloaded on 12 March 2006. 

Jenkins, P. D. 1987. Catalogue of primates in the British 
Museum (Natural 11 1 story) and elsewhere in the British 
Isles. Part IV: suborder Strepsirrhii, including the sub¬ 
fossil Madagascan lemurs and Family Tarsiidae. British 
Museum (Natural History), London, England. 

Jernvall, J., and P. C Wright. 1998 Diversity components 
of impending primate extinctions. Proceedings of the 
National Academy of Science 95:11279-11283. 


Kappeler, P. M., R. M. Rasoloarison, L. Razafimanantosoa, L. 
Walter, andC. Roos. 2005. Morphology; behaviour and 
molecular evolution of giant mouse lemurs ( Mirza spp.) 
Gray, 1870, with description of a new species. Primate 
Report 71:3-26. 

Kirkman, T. W. 1996 Statistics to LJse. http://www.physics. 
csbsiu.edu/stats/. (8 May 2007). 

Kumar, S., K. Tamura, and M. Nei. 1993. MEGA Molecular 
Evolutionary Genetics Analysis, Version, 2.1, Pennsyl¬ 
vania State University. University Park Press, Baltimore, 
Maryland. 

Longmire, J. L., G. F. Gee, C. L. Hardekoff, and G. A. Mark. 

1992. Establishing paternity in w hooping cranes (Grus 
americana ) by DNA analysis The Auk 109:522-529. 

Louis, E. E. Jr., M. S. Coles, R. Andriantompohavana, J A. 
Sommer, S. E Engberg, J R. Zaonarivelo M I Mayor, 
and R. A. Brenneman. 2006a. Revision of the mouse 
lemurs (Primates, Microcebits) of eastern Madagascar. 
International Journal of Primatology 27:347-389. 

Louis, E. E., Jr , S. E. Engberg, R. Lei, H. Geng, J. A. Sommer, 
R Randriamampionona, J. C Randriamanana, J. R. Za¬ 
onarivelo, R. Andriantompohavana, G. Randria, Prosper, 
B. Ramaromilanto, G. Rakotoarisoa, A. Rooney, and R. 
A. Brenneman. 2006b Molecular and morphological 
analyses of the sportive lemurs (Family Megaladapidae: 
Genus Lepilemur) reveals 11 previously unrecognized 
species. Special Publications of the Museum, Texas Tech 
University 49:1-47. 

Maddison, W. P, and D R. Maddison. 1992. MacClade: 
analysis of phylogeny and character evolution. Sinauer 
Associates, Sunderland, Massachusetts. 

Martin, R. D. 2000. Origins, diversity, and relationships of 
lemurs. International Journal of Primatology 21:1021- 
1049. 

Mayor, M I , J. A. Sommer, M. L Houck, J. R. Zaonarivelo, P. 
C Wright, C. Ingram, S. R. Engel, and E. E. Louis, Jr. 
2004. Specific status of Propithecus spp. International 
Journal of Primatology 25:875-900. 

Milne-Edwards,A., and A. Grandidier. 1875a. Histoire naturelle 
des mammiferes, Tome I, Texte I. In Histoire physique, 
Naturelle et Politique de Madagascar, Vol. 6, Les Indrisine 
(A. Grandidier, ed ). Histoire naturelles des Mammiferes. 
Imprimerie Nationale de Paris. 

Milne-Edwards, A., and A. Grandidier. 1875b. Histoire Na¬ 
turelle des mammiferes. Tome IV, Atlas I. In Histoire 
physique, Naturelle et Politique de Madagascar, Vol 9 
(A. Grandidier, ed. ). Histoire naturelles des Mammiferes. 
Imprimerie Nationale de Paris. 

Mittermeier, R A., W. R. Konstant, F. Hawkins, E. E, Louis, 
O. Langrand, J. Ratsimbazafy, R. Rasoloarison, J. U. 
Ganshorn, S. Rajaobelina, I. Tattersall, and D. M. Mey¬ 
ers. 2006. Woolly lemurs. Pp. 237-340 in Lemurs of 
Madagascar, 2nd Edition. Conservation International 
Tropical Field Guide Series, Washington, D. C. 



48 


Special Publications, Museum of Texas Tech University 


Myers, N. 2000. Biodiversity hotspots for conservation 
priorities. Nature 403:853-858. 

Nylander, J. A. A. 2004. MrModeltest v2. Program dis¬ 
tributed by the author. Evolutionary Biology Centre, 
Uppsala University, Uppsala, Sweden. 

Pastorini, J., M. R. J. Forstner, and R. D. Martin. 2000. 
Relationships among brown lemurs (Eulemurfu/vus) 
based on mitochondrial DNA sequences. Molecular 
Phylogenetics and Evolution 16:418-429. 

Pastorini, J., R. D. Martin, P. Ehresmann, E. Zimmermann, 
and M. R. J. Forstner 2001 Molecular phylogeny of 
the lemur family Cheirogaleidae (primates) based on 
mitochondrial DNA sequences. Molecular Phyloge¬ 
netics and Evolution 19:45-56 

Pastorini, J., U. Thalmann, and R D. Martin. 2003. A mo¬ 
lecular approach to comparative phylogeography of 
extant Malagasy lemurs. Proceedings of the National 
Academy of Science 100:5879-5884. 

Pope, T. R. 1996. Socioecology, population fragmentation, 
and patterns of genetic loss in endangered primates. 
Pp. 119-159 in Conservation genetics, case histories 
from nature (J. C. Avise and J. L. Hamrick, eds.). 
Chapman and Hall, New York, New York. 

Posada, D., and K.A. Crandall. 1998. Modeltest: test¬ 
ing the model of DNA substitution. Bio informatics 
14:817-818. 

Rasoloarison, R M., S. M. Goodman, and J. U. Ganzhorn. 
2000. Taxonomic revision of mouse lemurs (Microce- 
bus) in the western portions of Madagascar Interna¬ 
tional Journal of Primatology 21:963-1019. 

Reed, D. H 2004. Extinction risk in fragmented habitats. 
The Zoological Society of London 7:181-191. 

Rioux Paquette, S., S. M. Behncke, S. H. O’Brien, R. A. 
Brenneman, E. E. Louis, Jr., and F.-J. Lapointe. 2006. 
Riverbeds demarcate distinct conservation units of the 
radiated tortoise (Geochelone radiata) in southern 
Madagascar Conservation Genetics. (DOI 10.1007/ 
si 059.2006.92275.x). 

Ronquist, F., and J P. Huelsenbeck. 2003. MRBAYES 3: 
Bayesian phylogenetic inference under mixed models. 
Bioinformatics 19:1572-1574. 

Rumpler, Y., S. Warter, C. Rabarivola, J.-J. Petter, and B. 
Dutrillaux. 1990 Chromosomal evolution in Mala¬ 
gasy lemurs XII. Chromosomal banding study of 
Avahi laniger occidentalis (syn Lichanotus laniger 
occidental is) and cytogenetic data in favour of its 
classification in a species aparKTiz//?/ occidentalis. 
American Journal of Primatology 21:307:316. 

Sambrook, J., E. F. Fritch, and T. Maniatus. 1989. Molecu¬ 
lar cloning: a laboratory manual. 2nd ed. Cold Spring 
Harbor Press, New York, New York. 


Saitou, N., and M. Nei. 1987. The neighbour-joining meth¬ 
od: a new method for constructing phylogenetic trees. 
Molecular Biology and Evolution 4:406-425. 

Schneider, S., D. Roessli, and L. Excofier. 2000. Arlequin: 
a software for population genetics data analysis. 
Version 2.000. Genetics and Biometry Laboratory, 
Department of Anthropology, University of Geneva, 
Geneva, Switzerland. 

Smith, R. J., and W. L. Jungers. 1997. Body mass in com¬ 
parative primatology. Journal of Human Evolution 
32:523-559. 

Swofford, D. L. 2001. PAUP*. Phylogenetic Analysis Us¬ 
ing Parsimony (*and Other Methods). Version 4.0b5. 
Sinauer Associates, Sunderland, Massachusetts. 

Telenius, H., N. P Carter, C. E. Bebb, M. Nordenskjob, A. 
J. Ponder, and A Tunnacliffe 1992 Degenerate 
oligonucleotide-primed PCR: general amplification of 
target DNA by a single degenerate primer. Genomics 
13:718-725. * 

Thalmann, U., and T. Geissmann. 2000. Distribution and 
geographic variation in the western woolly lemur 
(Avahi occidentalis) with description of a new species 
(A. unicolor). International Journal of Primatology 
21:915-941. 

Thalmann, U., and T. Geissmann. 2005. New species of 
woolly lemur Avahi (Primates: Lemuriformes) in 
Bemaraha (central western Madagascar). American 
Journal of Primatology 67:371-376. 

Thalmann, U., and T. Geissmann 2006. Conservation 
assessment of the recently described John Cleese’s 
woolly lemur, Avahi cleesei (Lemuriformes, Indridae). 
Primate Conservation 21:45-49. 

Thompson, J. D. ; T. J. Gibson, F Plewniak, F. Jeanmougin, 
and D. G. Higgins. 1997. The ClustalX-Windows 
interface: flexible strategies for multiple sequence 
alignment aided by quality analysis tools Nucleic 
Acids Research 25:4876-4882. 

Wheeler, Q. D., and N. 1. Platnick. 2000. The phylogenetic 
species concept ( sensu Wheeler and Platnick). Pp. 
55-69 in Species concepts and phylogenetic theory: a 
debate (Q. D. Wheeler and R. Meier, eds ). Columbia 
University Press, New York. New York. 

Wyner, Y. M., G. Amato, and R. DeSalle. 1999. Captive 
breeding, reintroduction, and the conservation genetics 
of black and white ruffed lemurs, Varecia variegata 
variegata. Molecular Ecology 8:S107-S115. 

Zaramody, A., J.-L. Fausser, C. Roos, D. Zinner, N. And- 
riaholinirina, C. Rabarivola, 1. Norscia, I. Tattersall, 
and Y. Rumpler. 2006. Molecular phylogeny and 
taxonomic revision of the eastern woolly lemur ( Avahi 
laniger). Primate Report 74:9-22. 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


49 


Zhang, D.-X., and G. M. Hewitt. 1996. Nuclear integrations: 
challenges for mitochondrial DNA markers. Trends in 
Ecology and Evolution 11:247-251. 


Addresses of authors: 

Rambemntsoa Andriantompohavana 

University of Antananarivo 
BP 906 

Antananarivo 101, Madagascar 
E-mail: radarn byHDZ@yahoo.fr 

Runhua Lei 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. 10 ,h St. 

Omaha, NE 68107, USA 
E-mail: leir@omahazoo. com 

John R. Zaonarivelo 

University of Antananarivo 
BP 906 

Antananarivo 101, Madagascar 
E-mail: zaonarivelo@yahoo.fr 

Shannon E. Engberg 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. HP St. 

Omaha, NE 68107, USA 
E-mail: genetics@omahazoo. com 

Gerard Nalanirina 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. HP St. 

Omaha, NE 68107, USA 
E-mail: smallvaovao@yahoo. com 


Zimmermann, E., S. Cepok, M. Rakotoarison, V. Zietemann, 
and U. Radespiel. 1998. Sympatric mouse lemurs in 
northwest Madagascar: a new rufous mouse lemur spe¬ 
cies (.Microcebus ravelobensis). Folia Primatologica 
69:106-114. 


Susie M. McGuire 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. 10 th St. 

Omaha, NE 68107, USA 
E-mail: genetics@omahazoo. com 

Gary D. Shore 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. 10 lh St. 

Omaha, NE 68107, USA 

E-mail: genetics@omahazoo. com 

Justin Andrianasolo 

Center for Conservation and Research 

Henry Doorly Zoo 

3701 S. HP Si 

Omaha, NE 68107, USA 

E-mail: srna/lvaovao@yahoo. com 

Kelly Herrington 

Center for Conservation and Research 
Henry Doorly Zoo 
370I S. 10 ,h St. 

Omaha, NE 68107, USA 
E-mail: genetics@omahazoo. com 

Rick A. Brenneman 

Center for Conservation and Research 

Henry Doorly Zoo 

3701 S. 1(P St 

Omaha, NE 68107, USA 

E-mail: rabr@omahazoo. com 



50 


Special Publications, Museum of Texas Tech University 


Addresses of authors (cont.): 

Edward E. Louis, Jr. 

Center for Conservation and Research 
Henry Doorly Zoo 
3701 S. 10 th St. 

Omaha, NE 68107, USA 
E-mail: edlo@omahazoo. com 
E-mail: (Lab - United States): 
genetic s@omahazoo. com 
Email: (Field - Madagascar): 
kelynewsl@yahoo. com 



Andriantompohavana et al.— Woolly Lemurs of Madagascar 


51 


Appendix I 

The following Appendices to this publication are available online at the indicated website addresses. 

a. Avahi Field Data Appendix (Individual data hie for each Avahi, including morphometries, photos, sequence 
accessions, global position system, microchip data, gender, and location). 

http ://10.10.10.3/ccr/genetics/lemur/index, asp?page=ccr/genetics/lemur/Avahi.htm 

b. Appendix Primer Table I (Summary of designed primers for D-loop and PAST fragments). 

http: //www. omahazoo. com/ccr/genetic s/papers/appendixAvahiprimertablel. pdf 

c. Appendix Haplotype Table I (Summary of designated haplotypes for Avahi from Fandriana and 
Ranomafana localities for D-loop and PAST fragments). 

http: //www. omahazoo, com/ccr/genetic s/papers/Avahihaplotvpetablel .pdf 

d. Appendix ANOVA dendrogram of the morphological data summarized in Table 1. 

http ://www. omahazoo.com/ccr/genetics/papers/appendixAvahimorphodata. pdf 


Sample (98 Avahi and 25 outgroups total) used in the present genetic study and taxonomic revision of the Madagascar lemur genus 
Avahi, "TK Number is re ferenced voucher curated at the Museum of Texas Tech University. h Mitochondrial DNA sequence data for 
D-Loop (IN Loop or control region) and PAST (Pastorinifragment) for each sample are available from Gen Bank under the listed 
accession number . N/A signifies that sequence fragment is not available . (A. betsileo was formerly referred to as Avahi species nova 


52 Special Publications, Museum oe Texas Tech University 




oc 

ri 

O' 

rn 

-pj- 

in 

VO 

oo 

O' 

o 


CN 


in 

o 

in 

in 

<n 

o 

I-Tj 

m 

m 

O 

in 

O 

m 

o 

m 

o 

\Q 

m 

vO 

X 

vC 

X 

vO 

X 

vC 

m 

< 

vo 

n 

vo 

(N 

VO 

^O 

vD 

vd 






in 

oc 

IT; 

oo 

m 

in 

n 

in 

a\ 

Cv 

O' 

O' 

O' 

OO 

V", 

QO 

m 

oo 

oo 

oo 

oo 


X 

X" 

X 

yj- 

CL, 

O' 

> 

a 

> 

a 

a 

O' 

CX 

2 

£ 

lL 

Pl 

pL, 


o 

< 

D 

< 

Q 

a 

2 

Q 

UJ 

UJ 

UJ 

w 

Lj 


m 

m 

vO 

vO 

r- 


oo 

O' 

Tj- 

in 

vO 

t"v 

oo 

“p, 

T" 

o' 

r- 

O' 

r^ 

in 

r-' 

r- 


in 

yfi 

m 

m 

Q 

CP' 

X 


T 

O' 

r- 

O' 

Ov 

sO 

vO 

■o 

vO 

vD 


m 

X 

>n 

-rt 

m 


in 

in 






1 

a 

m 

oc 

a 

6C 

in 

>- 

m 

oe 

O' 

OC 

»n 

> 

m 

&o 

a 

oo 

tZ 

'n 

30 

a 

in 

oo 

2 

O' 

X 

u. 

O' 

X 

u. 

O' 

X 

Li. 

O'. 

X 

a 

< 


< 

n\ 

UQ 

a 

Q 

LLt 

UJ 

PU 

UJ 

UJ 


<x 


rn 

cn 

n 

m 

m 

(N 

CN 

en 

r-j 

m 

cn 



& 

■fr. 

-tt: 



=tfc 

Ctt 

=tt 

CTt 

=st 

=(t 

qfc 


U 

<u 

o 

6J 

CJ 

u 

u 

U 

O 

cy 

(L> 

CJ 

3J 


Q. 

CL 

Cl 

CL 

CL 

CL 

Cl 

CL 

CL 

Cl 

CL 

Cl 

CL 


in 


>■. 

>. 

>, 

+=l 

>t 

>> 

=M* 

;>. 

>. 

£* 

2' 






r >s_ 


■ 


'*** 

**** 



■*s« 

■»« 

■■Si 

zn 





!>*■ 




trj 

Vj 

tx 


4) 

33 

'si 

a 

3 


C3 


tj 


33 

33 

3J 

33 

V C 

k 


A. 

V. 

Is. 

L 

is. 

L. 

L. 

is 

i. 

L. 

L. 


_2j 


■E 


_0j 

■Si 

.gi 

.gj 

»Sii 

r ^t 

■£i 

x 

Qh c 




L. 

ji> 


^s 


£ 

l! 

2 


l! 

ITj ■- 

c = 

su 

5? 

QJ* 



Ej” 1 

rS 

C 1 


cy 




cl 

Cl 


cl 




Cu 


Cl 

Cl, 

Cl 

Cl, 

■i> cr. 


•**» 

* 

r, »* 


' 


1 


-■»*. 

■ B« 

' B-U 

1 Si 






-c 

-ir 




■5: 

X 

•X 

s_ cr. 

G CJ 

? 

r— 

33 

> 

J3 

> 

ts 

> 

ij 

s- 

!3 

> 

a 

33 

33 

> 

33 

S' 

3S 

> 

O Q 


X 

X 

X 

X 

X 

X 

X 

X 

X 

X 

X 

X 

o 



L 



L, 

L, 

«s. 

6, 

L 

v. 

L. 

L. 

r- 


d 


5 



ij- 

5l) 

CD 


cy 

Hi 

U 


-Sf 

•Sf> 

.tJj 

■Sf 

.gc 

r go 

.go 

,gO 

■£p 


3k> 

-Ep 

■SP 


s: 

& 

£ 

e: 


g* 

p*~ 

£ 

•‘fc. 

E: 

t~- 

•*«. 

S3 

£ 

« 1 

(3 





3 

v-J 

_5 


33 

33 

33 

33 














.= eb 
.2P « 






■im* 

-■* 

*»» 


1 "S* 

‘•s* 

‘St 

**s* 

-^1 


-4; 



-s; 

-e: 


-c 

-S3 

-S3 

-S3 

X 


£3 


a 


es 



C3 

33 

33 

33 

3i 

— <U 


P- 

p* 

> 



> 


> 

61 

> 

> 

> 

C Q 




X 

X 

X 



X 

X 

X 

X 

X 


























>, 












£ 

p 

E 

E 

E 










a 

Q 

Q 

Q 

Q 








2—\ 

2“S 


>, 

>. 

Sn 

>\ 




_> k 


>■> 


r >fc 


jz 

n 


-E 

JS 

■ U! 
eg 

JC 

J3 


o 

eg 

■U 

ns 


OJ 

o 

CO 

LL 1 

C3 

o 

eg 

<1> 

s 

O 

eg 

c 

63 

o 

63 

o 

4— 1 

eg 

c 

eg 


>*— » 

s 

rs 

4—* 

-2 

H — 1 

c3 

w 

i2 

eg 


x> 

^5 

_c 

-O 



eg 

eg 


eg 

C3 

c3 

eg 

eg 

£ 

p 

►=s 

E 

£ 

E 



H 

A 

E— 


H 

f—' 

H 

< 

< 

< 

< 

< 



/ 



^^ 






'—* 




eg 

eg 

63 


(0 

ns 

eg 

eg 

eg 

eg 

(0 

?3 

di 


c 

G 

E 


c 

a 

G 

C— 

e 

C 

c 

a 

C 



,cd 

,nj 

. eg 

f Cv 

r ro 

,eg 

,cg 

?g 

eg 

63 

nj 

f3 

r* 

4-. 

4-. 


U~* 





4—t 

Vi 

r, ^ 

l£J 

i*d 


eg 

eg 

nj 

eg 

e5 

eg 


eg 

rs 

<g 

63 

rz 

33 


£ 

*—i 

P 

p 

B 

E 

g 

r* 

£ 

i 

£ 

P 

B 

E 

"S 

o 

o 

5 

o 

o 

o 

5 

o 

o 

o 

o 

Q 

o 

u 

jp 

P 



c 

n 

c 

r— 

c 

c 

s 

C 

c 

o 

65 

ca 

nj 

eg 

co 

CO 

eg 

eg 

63 

Rl 

m 

03 

C3 


JV| 

cd 

d£ 

s2 

cd 

cd 

oi 


Dd 

Dd 

cd 

Cd 

ad 

a 

S-h 

U 



O' 

o 










X5 



oc 

O'. 


O' 








i—* 



r~ 

r^ 




r- 






jL b 

H 2 




m 


m 










c-j 

m 


nl 


n 











1 1 








a> 



O' 


CQ 

O'. 

3 

o 

CO 

o 

.—i 

tN 

<n 

X 


VO 

r- 

O' 

vO 


nj 

^r 


vO 

O 

vC 

vO 

vd 

o 

IQ 

V© 

■— 

rvi 

m 

m 

cn 

ni 


X 


J 

hJ 

o 

l_ ) 

C 

C 

o 

O 

O 

O 

O 

O 

o 

O 

O 

^ E 

2: 

2 

21 

2: 

£ 

2 


2 

2 

2 

2 

2 

2 

= 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

U 2 

ad 

Qd 

fy2 

r/ 

Od 

od 


Cd 

f* 


ad 

Cd 






Andriantompohavana et al.— Woolly Lemurs of Madagascar 


53 




ro 

Tt 


VO 


rs 

co 


V") 

■o 

r- 


oc 

O' 

O 



_o 

Tf 

Tf 


^r- 

m 

r^v 

co 

m 


r*3 


<n 

n 

■n 

■yQ 

vC 


E— 

■o 

vO 

VC' 

o 

\C 

vO 

vC 

■sD 

yO 

O 

VO 

o 

O 

o 

<o 

O 


f/5 

*—■ 

.-“■i 

-- i 

i —• 

p —■ 

--1 

- - 4 

_ 

p__l 

__ 


vO 

vO 

vC 

vC 

vC 


i 

o 

O'. 

O' 

O' 

O' 

O' 

O' 

O' 

O' 

O 

O' 

n 

n 

n 

m 

n 



y 

y 

rr 

"t 

rr 

^3- 

^r 



13 * 

^3" 

so 

oo 

oo 

oo 

oo 


CL. 



ti, 

Ll. 


1 ^- 

C- 

c- 

Cl, 

4-U 

Uh 

O' 

o 

o 

a 

O 



LJ 

U 

U-' 

LL 

i 

U 

UJ 

OJ 

UJ 

UJ 

W 

Ci 


Q 

Q 

Q 



GV 

o 


(N 

r^ 

oo 

o 

o 


n 

on 

o 


C3 

m 

Tt 


~p 

n 

vo 

vO 

■O 

-vf 


'3" 

'n 


in 

n. 

30 

O0 

30 

oo 

OO 


o 

vo 

o 

VO 

vo 

vo 

VO 

VC 

■o 

'■O 

-o 

VC 

O' 

q\ 

^ S - 

O' 

O' 



■—1 

1 -a 

i-i 

•—i 

m 

^—. 

■ 


— 

H—*—* 


•n 



•n 

m. 


w 

O'. 

O' 

O' 

o 

■o 

o^. 

O 

o 

O' 

o 

O' 

n 

LG 

MG 

n 

n 


._. 

1 

TT 

tt 

-^r 

^1" 

xl- 


'3" 

'Tf 

'3- 

Tt 

■r* 

30 

OO 

50 

eo 

cc 


Q 

— 

U- 

u. 


Ll. 


U, 

U- 

tL, 

u. 

tL, 

o 

O' 

O' 

O' 

O 



UJ 

UJ 

UJ 

3 

|_U 

H] 

U 

i__: 

UJ 

UJ 

u: 

Q 

Q 

Q 

Q 

Q 

















tt 

tt 

















c 

tt 



c3 

m. 

rn 

rj 

P-] 

r^i 


C'i 

m 

m 

n 

oi 

CJ 

C"l 

tt 

tt 



it 

Tt 

Tt. 

■4- 


bi- 

31l 

3t 


it 

it 


tt 

4t 

b 

v3 

s 



01 

0) 

o 

5> 

o 


1) 

o 

01 

5h? 

o 

0) 

o 

o 


o 



o. 

C. 

Cl 

Cl 

n 

£b 

Cl 

Cl 

Cl 

Cl 

CL 

CL 

CL 

o. 






>> 

>-> 

4mmi 

>-* 

>a 
-t—■ 

>x 

>> 

b 

b 

n 

■J—' 

b 

>, 

4 —t 

>, 

>, 

■u 


£ 



' 

•*-«i 

‘ ^ 



‘ Tv. 


•is. 


• pm 

■PM 

‘■»a 


■hN 

tt 

tt 


if) 


Lp*. 






C^j 



L-. 

r <> 



e: 

tt 


o 





?! 



t: 


P 

C 



tJ 

tt 

tt 


■ p 1 


L 

«% 



“H 


v. 

L, 

Ls. 

L. 

t. 

v. 

Jp. 















HI 


ii 

-S! 


S 


o c 







*-^* 


‘ ^ 







(3 


CL D 
C/> ■ — 


S. 

r\ 

p 

s«. 

2. 


S v 



L. 

p~S 



ir^-L 

i: 

C 




tj' 


sii 

5j’ 

'y 


■ii 


sa 

oy. 

Hi 



■ 

■ 


jC 





r^. 



Cl 

Ci, 

Cl 


Cl 

=L 



tt 


dj 1 OiJ 

" “V 



**»+ 

■ *^-. 

- ^ 


■I'm 

• '-V* 

• .-m 

- 

•m. 

1 ->-u 

■■PM 

• m 

1 *-m 



m _^- 








-5- 

-c: 


-s: 

'i: 

"S: 

-tt 

-tt 


fc V2 


■'W 

■^3 




r™ 








tt 

tt 


“ <l> 



> 




c 

> 

> 



> 


> 

> 

u 


O Q 





■^r 






X 


X 



'tt 



















H 


















z 


















0 


















U 




































1 

id 


















■n 


















"o 

1*. 

i*. 

ifc. 

L. 




“V, 

L 

L. 

V 

L. 

K. 

lw 

ly 

tt 


01 

'Ll 



Zn 



n> 





ta 

tt 

?u 

til 

*u 


5 

-S? 


■ g3 


?ic 

-Sf 

to 

.tc 

■$£ 

.tp 

.£c 

.a? 

-SP 

.Sp 

sr- 


mm 

■y> .i; 


cr 


T-< 



r-p 




s; 

E3 

e: 

s; 

tt 

tt 

Z 

n-p Pd 



s 

5 


■w 



!3 

p-P. 



tj 


tt 

tt 

r_> 

C3 

r ^-« 

'''-w 














■^ 


f— i— 


. _ _ 

- 

r m _ m 

, m _ U ' 

■ -_ 

. ^ 

.__ 

, 



. r _^ 


r 




r Id Of] 
Ofl ■ — 





-Zz 



'S: 


-s: 

■c: 


£ 

•E 

-5 

•tt 




tt 






a 

5J 

ts 

t! 



tt 

tt 

tt 




L*. 


?* 


> 


> 

> 

> 

> 

> 

> 

> 

> 

> 


o c 

> 


■^7 

y 


^r; 










X 





___ 


















>, 

>. 















E 

a" 

c 

E 
















Q 

b 

Q 

Q 















^ > \ 

>-i 

>! 



^—>, 




,—, 


,_, 


^^ 





r-* 

_g; 


i" 


C3 

c« 

sj 

(3 

X 

S3 

S3 

«3 






j ■ ! 

f !—'. 


frt 

L. 

h 


i_ 

L- 

1— 

Lh 

)-, 

i_ 

1_ 





W 


W 


z: 

C3 

cd 

(3 

f3 


C3 

03 

S3 

S3 





C 

o 

Ci 

G 

UnA 

'_. 

L. 

i_ 

i_ 

L, 

•— 

— 

1— 








•*** 

+—* 

HH 1 

4—« 


C3 

C3 

S3 

S3 

C3 

03 

03 

C3 

7S 





t’d 



C3 

_0- 

.E 1 

,&* 

E 

E 

C. 

E 

Cl 

pE 

,E 





-C 

-C 

r 4 

-S 

iT^ 

r" 

LiC 

.— 

f-; 

IS 

IE 

IE 

IE 


JC 

sz 





J -1 

G 

>-i 

t —* 

o 

o 

o 

o 

o 

o 

o 

O 

c 

o 





< 

< 

< 

< 

> 

> 

> 

> 

> 

> 

> 

> 

> 

> 








'—' 



** 


'y-' 




.— 






(3 



C3 

r3 

CS 

cd 

Pd 

efl 


03 

Pd 

03 

03 





.— 

G 

C 

p—. 

CI 

f—a 

#—• 

p— 1 

C 

c: 

c 

c 

c 

C 





,E 

r i^j 

cE 

,t3 

,nJ 


,s 

,3 

,c3 

r pd 

,s3 


03 

3 

Q 

Q 



r -f- 






G_ 

L—i 

L- 


C: 


U3 

UT 





c3 

CZi 

c3 

c3 

& 

C3 

pd 

rd 

n 

pd 

nj 


rz 

7Z 

_l_> 

rnlrnJ 


c 

i 

<- 

n 

E 

.— 

P 


3= 

E 

s 

Cl 

*—i 

p7-* 

p— 

B 

E 

E 

E 

E 

B 


<n 

o 

o 

~ 

o 

O 

O 

o 

o 

c 

C 

O 

c 

O 

o 

o 

o 



c 

ci 

c 

1“ 

o 


c 

!C 

c; 


C 

c 

G 

c 

G 

cd 


c 

o 


(O 

^3 



« 

ra 

03 

3 


<n 

S3 

<3 

§9 

pd 



PC 


ci 

Ci 


Ci 

Di 

Pd 

od 



cC 

PC 

Ci 

S 

z 


■nj 

3— 

OJ 












Ci 

CP 


-3” 



X» ! 












n 

n 


n 



c=* 

i*“ 












C" 

O 


T" 















n 

m 


n 



^! 
E— Z 












C') 

r-3 


(N 




(N 

r^j 


<n 



o 

._* 


m 

C3 








i—. 

■—- 


— 


30 

— 

“- 1 

—H 









cl 

vd 

sd 

\C 

vd 

vd 

o 

\o 

\£i 

vd 

\d 

<5 







cfi Jr n 

_i 


J 

— i 

> 

> 

> 

> 

> 

> 

> 


T 3" 

n 




WiJ 

C _D 

O 

5 

C 

C 

O 

O 

C 

o 

O 

o 

o 

(N 

C-J 

rn 




*3 £ 

Z 

z 

Z 

z 

z 

z 

z 

z 

Z 

z 

z 

Cl 

Ch 

c. 

vO 

O' 


3 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

o 

O 

C 

30 

30 


u 

cC 


PC 

Oi 

PC 

ad 

Ci 

ci 

ci 

PC 

pc 

> 

> 

> 


z 







Catalogue TK Location Original Species Current Species n- L oop b PAST 11 

Number_ Number __ Desig nation_ _ Designation ___ _ 

Ml 1 07 125755 Manombo Avahi lamger Avahi m. ramanantsoavana DQ855985 DQ856062 


54 


Special Publications, Museum of Texas Tech University 


rn 

Tf 

in 


c* 

QO 

O' 

o 

w— 

cs 


rn 

vC 

C* 

cc 

vo 

vo 

vo 

■o 

■o 

vo 

VC 

c- 

c* 

c* 

1^ 

r- 

c* 

C* 

c- 

O 

o 

o 

O 

o 

o 

o 

O 

o 

o 

o 

o 

CM 

Cl 

Cl 

VO 

VD 

sC 

vO 

vs 

VC 

'O 

vC 

vC 

-c 

X 

vO 

VC 

VO 

VO 

m. 

m, 

in 

■n 

m 

m 

in 

m 

m 

in 

in 

in 

o' 

On 

O' 

esc 

oo 

esc 

cc 

cc 

oc 

oc 

oc 

oc 

co 

so 

so 

ro 

m 

n 

O 

a 

O 

a 

o 

a 

a 

a 

a 

O' 

O' 

o 

X 

X 

X 

c 

a 

n, 

a 

c 

c 

C 

o 

a 

c 

a 

a 

W 

■X 

X 


vO 

r- 

esc 

O' 

O 

i— 

ci 

rn 


m 

vD 

r- 

0^ 

o 

,_ 

cc 

oc 

sc 

esc 

O' 


O' 

O' 

O' 

O' 

ON 

ON 

r- 

cc 

zr. 

o 

O' 

O' 

O' 

o 

Os 

O' 

Ov 

O'. 

Ov 

O' 

O' 

(N 

Cl 

cl 

in 

m 

'n 

m 

in 

in 

in 

m 

*n 

m 

m 

m 

SO 

vO 

vo 

m 

in 

in 

m 

»n 

in 

m 

in 

m 

m 

m 

■n 

OS 

ON 

ON 

so 

so 

oc 

oc 

oc 

oc 

oo 

oo 

cc 

co 

cc 

cc 


m 

m 

o 

o 

o 

a 

o 

a 

a 

a 

a 

a 

a 

a 

Ui 

X 

X 

Q 

nv 

c 

Q 

D 

n> 

■—■ 

a 

c 

Q 

a 

G 

D 

U 

Ll) 

LU 



3 

3 


13 

3 

3 









3 

3 

3 

r~ 

r* 

“V 

si 










’■Sal 

3 

a 

3 

3 

a 

3 













S' 


e* 










3 

■sj 

N 

■Nj 

3 











o 

0 ) 

Q 

Q 

o 

o 

O 










i3 

*3 

3 

3 

vrs 










r-- 

c— 

“V- 

c- 

3 

3 


z 









5 

3 

*»» 

NJ 

5 

3 

<3 










r-*- 

3 

3 

s: 

si 

3 

P>» 










—7 

<3 

—s 

3 

g 

5 


13 

o 

o 

Cj 

o 

o 

3 

H) 

3 

o 

HI 

3 


5 

5 

5S 


§ 


" 

■ *“H 



33 


‘*s* 

"^s 




i* 

K 



i2 




ti; 

trj 

i3 



£ 



S 

5 

lia 

~Cs 


■Oi 

He 

■Ci 

Hi 

*43 

■o 

HJ 

■c 

Hi 

*3 

■ ***. 

■ «^u. 

. ^ 

- 


‘■‘’Hi 

‘■^i 

*l^Sr 

■»» 



ri *«- 

r +H. 

**Vi 





^c- 





-£ 

-£ 

•ec 

*-c 

ji 


*5: 


3 

5s 

3 

gs 


3 

3 


ts 

3 

3 

3 

3 

3 


> 

> 



S' 

r 1 *- 

> 

> 


c- 

> 

> 

> 


X 




X 


'T 










S, 


+*m 

■s 

•s. 


V 

Is 

Vi 




i- 

3 

lv 





5J 

Hi 

Hi 

u 

as 

as 


as 

as 

as 

u 

^C- 

•SP 

be 

.£? 


.^p 

.EP 

■S® 

■5p 

■ *C 

.be 

■£P 

.iso 

*£p 

.£p 


p«* 

£ 

c* 

“s. 

c« 

■s, 

£ 

3 

tr 

e~ 

3 

V*rn 

•y- 

•r- 

£ 

3 

3 

3 

3 

53 

5i 

53 



3 

55 

3 

53 

3 

3 

3 

3 





rL 'Sl 



-^i 








. 



r 

• r_„ 


■ ^ 


" ■*# 



' Si 

- 

6 f»i. 

‘ *»+ 


C 


*^1 


■sE? 

-3 


-3 

-3 

-SI 

-3 

-3 

*3 

-3 

3 

3 


3 

3 

3 

3 

3 

3 

3 

5E 

3 

3 

3 

3 

S* 

r“ 

> 

r- 



c- 

> 

s» 



> 


> 

> 


X 

X 








X 



~x 



O 

c 

o 

o 

o 

o 

o 

o 

o 

o 

to 

o 

o 

C 3 

rs 

J 0 j 

_n 

JO 

JD 

JD 

X) 

X 

n 

c 

c 

e 

e 

c 

a 

C 

B 



s 

B 

E 

r“ 

c 

.2 

2 

-2 

cc 

■ 

.o 

.2 


,2 

o 

S 

o 

l“ 

cd 

cs 

a" 

o 

e 

o 

c 

o 

Q 

O 

o 

o 

e 

ns 

' ^ 

T 3 

C 

"U 

T 3 

C 

n 

TO 

c: 

|m 

C 

’C 

T 3 

C 

"C 

T 3 

c 

rj 

1 1_ 
TT 
O 

S 


% 

5 

S 

s 

o 

X 

O 

Lla 

(0 

Ll. 

K 5 

LLi 

O 

X 

m 

U- 

5 

(X 

O 

SX 


so 

c- 

cc 

O' 

m 

m 

m 

m 

O 

t- 

r- 

c 

m 

m 

m 

m 

Cl 

Ci 

cs 

Cl 







cc 

o 

-it 

m 

ON 

o 










i— I 

■—. 

* —i 

cs 

Cl 

vo 

c- 

O'. 

oc 

o 

ON 

o 

>n 

m 

»n 

G". 

•n 

■O 1 

< 

'3 

ca 

< 

^-=- 

cs 

ci 

ci 

Z 

ci 

Z 

ci 

Z 

vd 

Z 

vd 

Z 

X 

Z 

s 



1 


< 

< 

< 

< 

< 

< 

< 

< 






2 

U- 

EX 


X 

X 

X 

X 

X 









Appendix II (cont,) 


Andriantompohavana et al.— Woolly Lemurs of Madagascar 


55 



wo 


wo 

VC 

r- 

so 

O' 

0 


rJ 

cO 

Tf 

I/O 

vp 

O' 

oc 

■*1 

r~- 

r- 

t" 

r- 

T' 

r-' 

r- 

QO 

«J 

so 

oc 

CO 

sc 

CO 

co 

=c 

j— 

T'l 

fN 

o 

o 

o 

O 

o 

O 

0 

O 

0 

0 

0 

0 

0 

CP 

L 

or 

vC 

so 

VC 

VC 

vO 

vO 

VC 

vO 

VC 

O 

VD 

'O 

vo 

vo 

VO 

vo 

t>- 

CT- 

VO 

I/O 


wo 

wo 

wo 

wo 

WO 

WO 

wo 

wo 

wo 

WO 

wo 

< 

rO, 

rn 

oc 

oc 

SO 

so 

oo 

so 

so 

so 

SO 

00 

so 

oc 

CO 

cc 

Q. 

u. 

Ui 

(J- 

a 

a 

a 


a 

a 

O 

a 

0 

a 

a 

a 

C/ 

a 


Pl: 

c 

ro 

D 

Q 

Q 

Q 

D 

Q 

a 

0 

p 

c 

O 

0 


cl 

m 

cc 

O' 

o 

. 

CJ 

co 


wo 

VO 

ro 

oc 

CV 


0 

_D 

(■v 

oc 

oo 

O' 

O' 

o 

o 

o 

O 

O 

O 

0 

0 

0 

O 

,—i 


/-s 

(N 

cn 

O' 

O' 

o 

o 

o 

O 

O 

O 

0 

co 

0 

O 

0 

0 

w 

O 

vo 

SO 

WO 

I/O 

vO 

vc 

vO 

■d 

■O 

0 

vO 

vO 

vo 

VO 

vO 

VO 

T, 

cs 

0 s 

wo 

wo 

wo 

W: 

'Cl 

vo. 

vo 

wo 

wo 

wo 

vo 

wo 

vo 

WO 


ro 


oc 

oc 

30 

SC 

so 

SO 

sc 

sc 

00 

oc 

so 

00 

<?o 

co 

Q 

Uh 

Ll. 

O' 

o 

a 

a 

a 

a 

O 

a 

0 

0 

a 

O' 

cy 

a 


UJ 

LlJ 

c 

a 

a 

Q 

D 

a 

D 

a 

Q 

0 

o 

Q 

a 

p 




=fi: 

4t 

ot 

=tt 

it 

tt 

=«: 

C4- 


5! 

F J ‘ 

-a. 

S 






<U 

CJ 

a 

■"J 

CJ 

CJ 

CJ 

O 

CJ 

<u 

0 

w 

CJ 

y 




c. 

Cl 

CL 

CL 

to 

CL 

Cl 

CL 

CL 

CL 

P, 

CL 

CL 

CL 

HJ 

*o 

o 

o 

Sh, 

4—r 

i-V. 

>> 

l—i 

>n 

4— 1 

2/ 

-- 

2? 

X 

2:‘ 

X 

iZ' 

X 

2^ 

X 

X 

Z‘ 

X 

X 

So 

4-* 

X 

Hi 

Jxj 

•3J 


'll 

5 


01 

CJ 

su 

Hi 

HI 

Hi 

Hi 

CJ 

H) 

y — 

Cl. o 



.gp 

■‘S+ 

■S? 

.tp 

.bp 

.bp 

,bp 

.bp 

.bp 

.bp 

.bp' 

• SP 


-SP 

oo w 

<L 

■■■-4 
■JV 1 


S 

c 


S: 

& 

a 


£ 

SI 

s; 

£b 

s; 

Sb 

^ 5 

‘-LI 

.T, 

Jb3 


J3 

<3 

■3 

3 

C3 

bs 

bs 


Q 

J3 

bs 

j3 

c c 








—4 


0 ^ 

l ^*■■ 






flj Cfl 

t: ' £ 


‘o-, 

' *--. 

■Si 


p n^i 


' ’-- 


■ 

' 

' *-o« 

"^H, 

‘■x* 


' 04 * 

■^b 

-Sb 




1H ^ 


sz 

sz 


-s: 

sz 

-s; 


-Sb 

Jb 

t3 

‘vj 

x» 

lS 


Q 


a 

bJ 

b! 

bi 

bi 

bs 

bi 

3 

vl 

z; i> 

> 

> 

P* 

IV 

x 


■F-* 

> 

?! 

> 


L. 

c 

SL 

L 

L 

u p 



■^p! 

T; 

X 



or 

X 



■'b 

T 



ob 

•jj 

















_<u 

















o 

X 



L, 


S 

L. 

x 


X 

X 

X 

X 

X 

X 

X 

<l> _ 

tu 



Oi 

:b 

Cu 

cu 

O 


Hi 

Hi 

Hi 

HI 

Hi 

Hi 

Hi 


■Sf 


.£C 

.go 

.60 

.bp 

.bp 

.bp 

.bp 

,£p 

.bp 

.Sf 

.bp 

-tp 

-Sf 

-SP 

00 . ~ 

$b 

L*». 



JSi 


T*- 


£ 

Sb 

Sb 

k: 


5b 

& 

S3 

kj 2 

bi 

b3 

Cl 

& 

•S» 

fSp 

sj 


-5 

J3 


~s 

b; 

bi 

bi 

bs 


.5 oj> 
•— 1 




. ^ 


‘ ■-M. 




*•»* 

■ 


Tn 

■ *« 





-s: 

-v: 



sc 

-x: 

sz 


sz 

hs; 


-IT 

-t 

~Sb 

bs 



■X 


o: 


Cj 

CJ 

bJ 

b! 

bj 

bs 

bj 

vb 

bi 

J—i CJ 1 

> 

C. 


> 

> 



s* 

> 

X 

X. 

> 

> 

L 

L 

> 

O Q 


'T 


t; 




0 : 






X 

™ 
















(JL 

P, 

_L 














U 

O 

U 

O 












c_ 

a. 

73 

ns 

nl 

m 

r- 

73 

1" 


ra 

■crJ 

C3 


,E 

.3 


.2 

Z 

.2 

Z 

.2 

JC 

N 

— 

« 

N 

■s 

tx- 

■i 

St 

a 5 

.2 

.rtS 

T3 

T3 


'tj 

00 

T3 

■5 

■5 


mj 3 

s 

E 

E 

E 


1 u. 

‘ u_ 

03 

O 

C3 

ej 

71 

Oi 


n3 

<d 

a 

fS 

o 

T U' 

"P 

-4—* 

4—» 

r- 

-i—• 

r- 

4—» 

c 

*— » 

c 

4 / 

C 

c 

c 

c 

4 —. 

p 

s 

0 

Ih 

c 

Lh 

0 


£Z 

— 

s 


^3 

c3 


ns 

ns 

od 

n 

ca 

73 

S3 

S3 

C5 

■ 

U- 

<13 

£X 

s 



S 

S 

2 

S 

S 

S 

S 


s 

s 

S 

™i- 

Cl 




cz 







oi 






JZ 




vo 





vO 


O 






— 




r~ 





to. 


ro 










wo 

C'] 





wo 

(N 


wo 

Oi 






u Z 

















0) 

= ^ 
on hj 

o 

— 




O'- 

vO 

to. 

m 

so 

av 

0 

OJ 

0 

OJ 

rO 

rf 

Sc — 

vo 

vd 

*— 

(N 

ro 


co 

co 

of 

-oH 


-rf 

< 

< 

< 

N 

<; 

nS £ 

z 

Z 

p 

a 

D 

O 

O 

Q 

D 

a 

D 

Q 

Ext 

N 

N 

ca 3 

< 

< 

< 

< 


< 

< 

< 

< 

< 

< 

< 



1—! 

H—! 

u z 

[J- 

u. 

E- 

E- 


H 


h* 

E— 

H 

H 

2 

% 

s 






56 


Special Publications, Museum of Texas Tech University 



O' 

o 


CN 

on 

tt 

■n 

vo 

r-' 

=o 

O' 

o 


CN 

co 

rr 


SO 

O'. 

c> 

O'. 

O' 

O'- 

O' 

‘O' 

O' 

O' 

O' 

o 

o 

O 

o 

o 


o 

o 

o 

o 

o 

o 

o 

o 

O' 

o 

o 

—i 

~—i 


— 

,- 

& 

vO 

vO 

vO 

o 

<o 

vO 

o 

vo 

■o 

vO 

1 C 

vo 

ic 

■o 

vo 

O 

in 


in 

Wi 

in 

in 

>n 

m r 

m 

in 

m 

m 

<n 

m 

in 

in 

< 

3 G 

go 

GO 

30 

CO 

CO 

30 

oc 

oc 

30 

oc 

30 

co 

CO 

oo 

oc 

o_ 

a 

a 

O' 

a 

a 

a 

O' 

a 

o 

a 

a 

a 

a 

a 

a 

a 


Q 

c 

Q 

Q 

Q 

a 

a 

c 

Qt 


a 

a 

c 

a 

Q 

Q 


<N 

CO 

Tt- 

in 


r- 

30 

O' 

o 


CN 

m 

N|- 

m 

vo 

r~~ 


*— 1 

— 

-—■ 

— 


— 

•— 


cn 

CN 

CN 

cn 

(N 

CN 

CN 

CN 

-—x 

e“i 

O 

Q 

cs 

o 

o 

o 

o 

o 

o 

O 

O 

o 

o 

o 

O 

o 

xJ 

fTl 

VQ 

vO 

o 

VO 

o 

■o 

o 

■o 

so 

vO 

vD 

■o 

vo 

VD 

ID 

V 0 

J 

m 

in 

to 

in 

>n 

m 

in 

in 

m r 

m 

m 

in 

m 

m 

■n 

in 

co 

oc 

30 

30 

30 

oO 

co 

CO 

oc 

oc 

oc 

oo 

oc 

30 

oo 

oo 

Q 

a 

a 


a 

C 7 

a 

o 

a 

a 

a 

CX 

a 

O' 

a 

a 

a 


Q 

c 

a 

Q 

a 

c 

a 

a 

a 

Q 

Q 

a 

Q 

a 

a 

Q 



r *T, 

r^* 

_Ln 

.n 

. ^ 

.Jo 


C>] 


*«3 

■ *« 

■•h 

CN 

m 

nj 

rN 

CN 

CN 


\s 

"3 


■•-J 



C 3 


vj 

\J 

■tt 

=tL 


Nt 

St 

4 t 


s 

3 : 





s: 

r-- 

C^“ 


C 3 

a> 

CJ 

1 > 

CJ 

0 > 


■XJ 

o 

o 

3 

o 


C! 

3 

o 

O 

CL 

CL 

CL 

CL 

CX 

tx 

en 

a> 

“!*» 





% 




Cx 

4 -^ 

>■> 

w 


>v 

£> 

3 ' 



§>h 

X 


X 

X 

X 

2 ! 

n% 

■X 


X 

■> 

X 


X 

u e 
cx o 



co 



Xi 

X) 




s> 


Xi 



XJ 








ss 

■x. 


£ 


.^p 

■Sf 

.bp 


- 5 £ 

V> ■- 












£ 

£ 

sr 

A. 

e: 



•»»* 

X 


•^v 


Ej 

si 

K 

si 

3 

cs 

es 

a 

C 3 

C 3 

c g 

“*■ 














" V *N» 


a> cjj 

+—i ■ 


■l». 



r —^ 


1 


1 •** 


“Hh» 

-x* 



’•x. 




-s: 

^7 



-or 



_rx 

Nr 

nt 

NT 

Nr 

NT 

NT 

Lm t/Z 


J: 

5 ! 

Ss 

vi 

Cj 

vi 

-3 

t 3 

NJ 

vl 

r: 

C3 


C3 

rs 


r-* 


3 




S» 




> 

X 


> 

> 

X 

O Q 











N- 

X 







c 

z 

tin 

a. 

a. 

< 


O 


o 

'■-V. 

X 

X 

L-. 

X 

X 

X 

X 

X 

3 x„ 

X 

CJ ,_ 


50 

5 J 

qy 

X 

to 

Lt 

w 

ty 


5 J 

r-i. Ei 
■ n* [3 

,^C 

.bp 

,00 

■SP 

■Sf> 

£f 

- 5 p 

SP 

,SP 

-Sf> 

. 5 ? 

(/: .a 

11 j 

■F' 


r-. 

“-T 


£ 


Fvi 

-*Si 

SXi 

-x 

sr 


sr 

■ 7 ; to 




■sj 

b: 

<3 

n 

n 

n 

a 


2 = 




r ^“ 



-.. 





.= -i> 

hfi ■ “ 




N: 



-5 

-S 



‘■» 

~sr 

--n 

£ 

r: 

n 

9 



b! 

bs 

-3 

t 3 

bj 

‘— a> 

> 

X 

X 

r* 



x 

r** 

L 

X 


c 0 


X 

X 

X 


n: 

X 


~ 







b 


c 

C 

Lj 




O 

0 

0 

0 

tO 

o/> 

S/j 

olj 

P—1 

c 

z 

. 

s 

03 


(3 

n-t 

C 

r“ 

F^-- 

s 

co 

rs 

s 

> 



S 

■-“N 

X-> 



cz 

J3, 

C3 

(5! 

aj 

CJ 

U 

CJ 


r~ 

r -1 

J= 

rs 

CS 

“ 


I—* 

n-i 

JZ 

3L 

O 

O 

O 

O 

-O 


T3 

T3 

1 “ 

r“ 

c 

C 

< 

< 

< 

< 





? ^ 


cn 

t 

eg 

i 2 



O 

+—' 



eg 

c 

3 

O 

^-> 

oO 

3 J 0 

SJQ 

1 “ 

r- 

Z 

z 

O 

C 3 

cc 

eg 

> 

5 

S 3 

eg 

El 

eg 

*—* 


S 

g 

CC 

— 


x—N 


O 

Cg 

-2 


1 

f 3 

CJ 

D 

OJ 

<TS 

■s 

■s 

<3 

33 

7 " 

-C 

r - 1 

O 

0 

0 

5 

TZ 5 

*133 

-a 

G 

C 

f—| 

c 


< 

< 

< 

s 


-a 

3 

<g 

;g 

c 

o 

> 


o 

z 

A 

x. 

Cg 

e 

eg 

c 

eg 


to 

3 



T3 

X. 

O 

Z 

i 

2 

<s 

E 

eg 


£ 



-•—■- 


*T3 


T3 

3 

3 

3 

t>p 

00 

EiO 

(fl 

eg 

eg 


-N 


tg 

eg 

eg 




z 

3 


0 

O 

O 

> 

> 

> 


_ 

H 



--. 

T5 

■a 

Tg 


X 

X 

0 

O 

0 

^■, 

Z 

z 

i 

eg 


1 

« 

i-ri 

S—1 

i-. 

eg 

rt 

nj 

Z 

j—1 

El 

(g 

s 

?3 

c 

r—* 

E 

eg 

ra 

eg 


s 

s 




CJ 

m 

■TT 




’-T; 








VO 




■O 

vO 












VO 



f— 

n- 

r- 




r^ 








t- 



V/ x 

n 

n 












n 



* fE 

n 

CN 




(N 











H Z 






























0 


cn 


u 











~ 

CN 

— 1 

*— 

— 

— 

00 b 




—, 

01 

m 


0 

C^j 

tT 


TT 

Tf’ 

Tf 

Tf 

Tf’ 

^ _E 

TT 

m 

O' 

’—« 





rn 

m 

< 

< 

< 

< 

< 

< 

S E 

c 

Q 

Q 


a 

a 

5 

Q 

c 

a 

cd 

ctZ 

K 

C£^ 

2 C 

& 

b ej 

z 

Z 

Z 

z 

z 

z 

z 

Z 

z 

z 

< 

< 

< 

< 

< 

< 

0 z 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

Z 

z 

z 

Z 

z 

z 







Catalogue TK . Original Species Current Species b u . tT b 

vt L u a Location ~ . . r ^ t D-Loop HAS l 

Number_ Number ___ Designation _ Desig nation _ J_ 

NARA4.18 125767 Mananara-Nord (Ivontaka-Sud) Avahi laniger Avahi laniger type #2 DQ856028 DQ856105 


Andriantompohavana et al.— Woolly Lemurs of Madagascar 


57 


so 

t— 

CO 

O' 

o 

1—* 

22 



so 

SO 

r- 

oo 


o 

o 

o 

o 

o 

— 



■—* 



1 

*—* 


— 

<N 

—— 

—— 

— 




f— 


»=• 

— 


T—, 

— 

™—i 

i=* 

so 

so 

vo 

vO 

SO 


so 

SO 

SO 

SO 

s£5 

o 


sC 

SO 

vn 

so 

SO 

so 

so 


so 

*r-j 


so 

SO 

SO) 

so 

tOi 


30 

eo 

30 

&o 

OO 

oo 

oo 

cc 

GO 

oo 

50 

DO 

oo 

oo 

50 

a 

O' 

r"v 

*W 

o 

a 

O' 

a 

o 

O' 

O' 

a 

O' 

o 

a 

a 

Q 

Q 

c 

Q 

Q 

Q 

Q 

Q 

Q 

Q 

a 

G 

c 

c 

G 


os 

O 

.— 

rN 

CO 

x 

so 

so 

r- 

50 

Os 

o 

.— 

CN 

CO 

CN 

CO 

CO 

ro 

co 

CO 

ro 

ro 

co 

co 

ro 

T(- 

X 

X 

X 

O 

o 

o 

o 

O 

O 

O 

O 

o 

o 

O 

o 

O 

o 

o 

O 

SC 

SD 

so 

so 

so 

SO 

so 

so 

so 

sO 

vO 

so 

so 

so 

to 

so 

IO 

so 

SO 

SO 

so 

so 

so 

so 

VO 

so 

vo 

VO 

vo 

50 

oc 

30 

DO 

oO 

oo 

50 

cc 

50 

50 

50 

50 

50 

50 

55 

O' 

a 

a 

a 

a 

a 

O' 

a 

a 

O' 

a 

a 

a 

a 

a 

Q 

G 

G 

a 

a 

Q 

Q 

a 

G 

Q 

G 

G 

G 

o 

a 


cn 

n 

rN 




























o 

<U 

31 










>5 


■ 2 

CX 

Cl 

CL 














£r‘ 

L. 











!3 





c 

o 

_o 

o 

* 


‘♦i* 

■ “»* 


S3 

l 


<U 

bC 

ft) 

,bo 

5 


r > 

"3 

"5 

vy 

'O 

ft) 



Xi 






.Si 

SJ 

j 

.Si 





Xl 





ts* 

**- 

§ 

£ 

s 

£ 

£ 



Jlj 



o 

Si 

Si 

Si 

SJ 





a 



~G 

Sj 

■o 


2j 

Cs 

D 

31 


2b 

J*- 


',F, 

-S3 

^£ 





r, h^, 

-s: 


-5 

■ 

-S3 

■ 

-S3 




ro 

S3 



si 

3: 


53 

3 


31 

31 

> 


> 

X 

> 



£**■ 

> 

c> 

> 

> 

Ss 


> 

X 



X 

X 

X 

x 

X 

x 

X 



■o 
















-is 

■Ea 

,Eg 













■". 















33 

"S 

"5 

, 



Q 

-2 






■ 


1 

S3 

*Ft 

K 

5 

be 

s 

5 

.bC 


o 

s 

si 


xi 

■o 

5 

in 

XJ 

Cf, 

XI 

jx 





l> 

J3 

s 

.Si 

£ 

SJ 

■ >-■-* 

,o 

T** 

***. 


xi 

Si 

XI 

-2 

XJ 

D 

31 

31 

O 

X) 

SJ 

Si 

<3 

Si 



3 


31 

’o 

23 

■Si 

2j 

2j 

O 

O 

O 


■►v. 




'P6* 

>Si 

■ 

-m*. 


■- 

*■!»* 

-«» 

4 r** 


-S3 



m f^- 

«^S: 


-3 

-S3 


33 

J3 

-S3 

-C 

-g 

-J3 

31 

^3 

31 


3! 

31 

3 

3S 

31 

3i 

ro 

31 

33 

t3 

33 





> 

3> 

> 


3- 

> 

> 

;> 


o 

> 





X 

X 

X 

X 

X 

X 

X 

X 

X 

X 

X 



"^5 

TO 














3 

3 













{/: 


LO 













sXJ 

5 

A: 

2 

4CJ 

<TJ 

'cd‘ 

i_ 

"a 

■—■ 

U- 

“O 

e: 

R3 

Li 

cs 

cd 

Li 

"Q 









r—• 

3 

> 

2 

O 

> 

r^; 

5 

> 

E 

E 

Cd 

e 

_c5 

£ 

se 

^3 

efl 

J=: 

is 

j=, 

73 

-S 

cd 

■s 







o 

o 

o 

0 


C3 

rfl 

«3 




n, »^-« r ' 



k- 

1-4 

1_ 

u 

1-, 

!_ 

i_ 

u 

Li 




'p 

5 

1 r ; 

TO 

c 

?3 

E3 

es 

^5 

CJ 

C3 

(C 

n3 

m 




<■-/ 

i- 

o 

g 

s 

g 

S 

B 

u 

E 

3 

1—. 

c 

iy 

E 

i> 

E 

Ci 




PT 




o 

O 

D 

CQ 

OQ 

CQ 

£2 

CQ 




1 

RS 

if 

r3 

S-i 

i 

XS 

ie- 

CS 

u 

■—C 

C 

L-. 

o 

c 

i_ 

T3 

c 

L- 

"O 

i —<■ 

m 

*o 

a> 

TO 

o 

TO 

<u 

TO 

Hi 

TO 

O 

H 

O 

n 

03 

o 

a 

■73 

B 

ra 

£ 

n 

C3 

3=: 

r~* 

3 

vE 

<2 

eg 

v£ 

eg 

>o 

4i 

2 

fO 

5fl 

c 

cB 

c 

oB 

c 

>;. 

oa 

c 

_c 

Li 

.2 

'Li 

L 

2 

Li 

2 

4 L- 

3. 

cd 

5 

C 

< 

c 

< 

E 

< 

£ 

< 

U1 

E— 

cr 

H 

* s 

H 

t/i 

F—I 

trt 

H 

cd 

cd 

cd 

2 


cc 

O' 

o 

—i 

CN 

CO 

Tf 

so 


r- 

r- 

r- 

O- 

»■ 

t> 

r- 

t" 

r- 

r- 




vo 

50 

>o 

so 

SO, 

so 

OJ 

rl 

cn: 

or 

OS 

c-i 

O'] 


co 

—■ 

OJ 













CN 

co 

CO 



o 

or 



r-] 

co 

or 




Tf 

of 

Tf 

OO 

Cs 



oc 

O' 

— 

“■* 

-—. 

O' 

so 

CN 

< 

< 



vo 

to 

SO) 

< 

< 

< 

< 

< 


x 

fE 

so 


ll 

c£ 

H 

h- 

H 

u 


£ 

2 


£ 


< 

< 

< 

Z 

z 

z 

Z 

UJ 

ll 

ll: 

s 

ue 

< 

>■ i 

< 

< 

—H 

Z 

z 

z 

< 

< 

< 

< 

ee 

OQ 

09 

2C 

ac 


S 

s 






58 


Special Publications, Museum of Texas Tech University 




PI 

n 

rf 

VP 

<p 

vo 

PI 

CP 

<p 


rr 

rp 


PI 

oc 

r-. 

fN 

rl 

PI 

pi 

pi 

rr 

rr 

vo 

VO 

*p 

VO 

ip 

tp 

iP 

ip 

rr 


— 

— 


— 

-— 

vp 

VP 

ip 

ip 

ip 

tp 

tp 

tp 

ip 

ip 

ip 

C/3 

VO 

o 

VO 

VO 

c 

CN 

PI 

PI 

P-l 

P4 

P-l 

PI 

PI 

PI 

PI 

p| 

IP 

ip 

ip 

>P 

tp 

oc 

oc 

CO 

co 

CO 

CO 

cc 

DO 

OC 

oc 

oc 

< 

=C 

oc 

50 

OC 

oc 

'p 

>P 

tp 

pi 

■p 

ip 

ip 

tP 

tp 

ip 

ip 


O' 

a 

a 

o 

a 

> 

>" 

>- 

> 


> 

p" 

> 

> 

> 

> 


a 

r*' 

P, 

G 

G 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 


TT 

tp 

VO 


co 

*P 

PI 

cc 

o 

rf 

oc 

cp 

PI 

o 


CO 

cx 

rr 

rr 

rr 

-rr 

rr 

Ov 

PI 

(O 

'P 

cv 

rp 

Ov 


Ov 

to 

so 

o 

o 

o 


o 

vo 

r-' 

PT 

o 

'S' 

p- 

tT 

tr 

rr 

rfr 

rr 

v—<■ 

vo 

vO 

vo 

vO 

O 

O 

ov 

TT 

rr 

rr 

ip 

rr 


rT 

vt 

rr 

w 

*p 

ip 

<Pi 

vp, 

Ip 

tp 

»p 

oO 

<p 

co 

CO 

DO 

» 

oo 

OC 

oc 

O0 

oC 

oc 

CO 

CO 

-—, 

■ —i 

ip 

pi 

vp 

ip 

VP 

IP 

tp 

ip 

tp 

i 

Q 

a 

O 

O' 

o 

o 

> 

> 


> 

> 

> 

> 


> 

> 

> 


D 

Cl 

c 

a 

G 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 

< 



i 

■ 








eg 









-j£ 

ca 

:z 

P 

_> 


0 

O 

o 

o 

o 



3_ 

£ 

c 

eg 

c 

73 

S 

5 

5 

r eg 

Or, 

CCJ 

eg 

G/J 

. W 


1 — 



t- 

P3 

p 


rd 

S 

eg 

2 

3 

C3 

L* 

C3 

o 

c 

a 

o 

> 

4 s- 

eg 

E 

'C 

eg 

s 

"C 

fS 

i—« 

cd 

s 

eg 

£ 

j; 

C 

< 

C 

53 

tti 

s 

s 


K3 

p 

t*- 

tfj 

g 

53 

c 

.2 

5 

0 — 

P3 

p— 

i— 

<r} 

c 

o 

£ 

C3 

P 

iZ 

t—I 

■u 

£ 

c: 

G 

P 

eg 

c 

CJ 

p 

o 

a 

> 

eg 

o 

■a 

C 



S— 

O 

— 

O 

s' 

p-l 

S 

c 

53 

so 

53 

C3 

c 

75 

G 

r* 

S 

f3 

C3 

■ 

ci 

Uh 

Qi 

< 

< 

oi 

ed 





JD 

E 

Z 


o £ 


■3 £ 

cc =3 

U Z 


rr 

ip 

vO 

o 

,_j 

tp 

ip 

'P 

vo 

vo 

dc; 

cd 


CiL 

u. 

< 

< 

< 

< 

< 





2 


z 

< 


a 


pv 



tp 


PI 


tp. 

pi 


PI 


rr 

c 

oc 

o 

pi 

o 

Z 


z 

z 

z 

< 

< 

< 

< 

< 

al 

a 

c2 

llw 

o=: 


co 





PI 


_ __ 

PI 


pi 


\D 

vo 

PI 


Ov 

o 

o 

■y 

< 

z 

PC 

< 

z 

< 

z 

A 

< 

< 

o 



2 








Appendix II (cont*) 


Andriantompohavana et al.— Woolly Lemurs of Madagascar 


59 



r- 

o 


O' 

o 



■0 






r- 


tt 

%r 

tn 

•rt 

in 



in 






n 

E— 1 

OT 

m 

m 

<n 

C"! 

in 

on 

VO 

o 

o 

< 

< 

in 

m 

< 

< 

< 

< 

< 

n 

ni 

oc 

oc 

SC 

in 

m 



so 

’■■■^ 



2 


00 

< 

in 

m 

<n 

oo 

oo 

2 

2 

in 

2 

2 

2 

2 

n 

cu 

> 

> 

> 

a 

a 



> 








< 

< 

< 

i—( 

Q 



< 






< 


O' 

o' 

oo 

O'- 

T' 

O' 

0 

CN 

50 


<n 

0 

CN 

O 


rf 

oc 

*sf 

O 

o 

■0 

m 

m 

■o 

r- 

r- 

r- 

r- 

fn 

Phi 

C 

*0" 


O'- 

a\ 

O' 

O' 

r' 

o^ 

O' 

O' 

O' 

O' 

r- 

o 

Tf 

TT 

■0* 

in 

m 

m 

m 

n 

n 

<n 

in 

n 

in 

m 

Q 

in 

5C 

in 

m 

m 

m 

m 

so 

in 

in 

in 

in 

m 

0O 

_I 

(N 

in 

ri 

oo 

oo 

00 

00 

in 

00 

oc 

so- 

00 

00 

in 

V 

Q 

> 

> 

> 

a 

a 

a 

a 

>■ 

a 


a 

a 

O' 

U- 

< 

< 

< 

D 

Q 

c 

a 

< 

a 

n 

0 

a 

O 

< 

\ 











■ V 

r— • 

“V 
















Srt. 














vl 

V 














2 










in 


— 


j *»+ 


a 

‘•h 

■ Hu, 



rt 

5 

rt 

5 



■a 

■■0 

^3 

£ 

V 

<3 

Jfc 

V 

o> 

t 

§ 

!> 

■ilN^ 

s: 

-g 

c 

y 

■V 

Li 

**v* 

C3 

£ 

0J 

■»vj 

3! 

cu 

t 

■S 


Sv 

£ 

k. 

*vi 

C3 



5! 

O 


'J 

Hi 

8 


13 


Si 

> 

<j c 

“ 





10 

to 

rt 

rt 



rt 


2]- 

c. O 


>» 

*v 



‘V., 

■v* 



Vrt* 

ss 

a 

a 

a 

cr, 

*-> co 

c c 




Sta. 



'O 

■o 

U 

G 


L> 

Ll 

Li 


■v 


^5 

^2 




0> 



L> 

L> 


#»* 

<d 

5 

r* 

r» 

Vi 




V* 


“53 

cS 

-S3 

V< 

oj s/i 

i_ -»-* 

; 

i ^ 

O O 

■w 

£ 

~5 

f 

~S 

s- 

■s 

■£ 

l 

> 

'-w 

! 

1 

s- 

£ 

f 

=£: 

*1^ 

1 

'-M, 

"‘Hu. 

L 

*»v,. 

*L 

■•v, 

g- 












£ 















cu 
















5 *Tt 





























Cu- 





3 

g 

Crt 

V* 

S 



3 

'S 

-V. 

2 

V 

^5 

[rt 

■HJ 


■ 1 ^ 

"5 

3 

mi 

'tr 

^3 

t 

s 

5u 

O 

L> 

* "m, 

£ 

CD 

'•v* 

C3 

J) 

C 

V 

G 

« c 

£ 

C<3 

Vu. 

L_i 




53 

CJ 

% 

3* 

SJ 

0 

u. 

oj 

■’S 

TS 

’*>w 

01 

S>- 






to 

(rt 

[rt, 

rt 

rt 

rt 

rt 


rt 

CL S 

1*. 

Hu— 

-V. 

V* 


r ^ 

..__ 

■v4 

--_ 

51 

=3 

■4 

Mj 

a 

’■Vi 

a 

{/) .a 

■Ki 



X 


CJ 

v> 

U 

CJ 

Cj 

■Li 

Cj 

G 

L> 




<>- 


>3 

<it 


cs 

Cj 

<u 

Hj- 

CU 


ID 


s 

3 

S 

tv. 




-s; 


■« 




35 

,E iij 

1 ,^P V) 


*"5 

fS 

& 

j 

■ 7 - 

- “~-i 

CX, 

s. 

£. 

S. 

"S. 

'5, 

’5, 


& 






0 

CJ 

CS 


LT 

0 ^ 


0 



a- 



V 

V 

IW 

V 


i> 

i. 

V 

V 

o a 

*—* 

V, 



“V 


rt 

—-, 

CX- 

Oh 

CL 

CL 

CL 

CL 

CL 

: 












cO 



1 

: 

■ 












X3 








T3 


■0 





cO 








3 


3 





(O 








c n 


cn 

1 





E 








o 


0) 


co 

(O 


0 

co 




CO 

c3 

co 


C3 

X3 


(H 


CQ 




E3 

C 

c: 





0 

(rt 


O 



c 

r e0 

+— 

r3 

r ^: 

-+— 

CZ 

,co 

l+H 

(0 

cd 

cd 

b N 

1—1 

C5 

Jj 

.2 

.^3 

■U 


0 

•a 

CJ 

£ 

C’d 

cO 

JxC 

Q 

cO 

CJ 

c 

s 

o 

c 

co 

IT"! 

o 

5 

3 
«—< 

CO 

3 r 

H” 

c 

p 

cd 

cO 

r-“ 

cd 

E 1 

"O 

co 

H 

eo 

E 

0 

c 

73 

— 

^di 

3 

03 

O 

111 

c 

vi 

(0 

X3 

03 

lO 

> 

cO 

O 

X3 

O 

V- 

y 


£2 

Qd 

SsC 

< 


< 



< 

CD 

f— 

< 

Q 

m 

V 















<u 















Xi 















E 















h* 2 















a> 

oo 


M 





n 







on 

Vi 

in 


rn 



m 

0 




n) 


do G 

O jz 

on 

m 

m 


>n 

c 


cn 

m 



TT 

o 

00 

o 

o 

c 



O 

T 

ni 

< 

T^ 

** 

10 

cO £ 

2 

2 

2 

-2 

K 

ci 

a 

2 

< 

pd 



DC 

QC 

rtl 

to 2 

< 

< 

< 

< 


< 

< 

2 

C 

tIJ 


< 

c 

O Z 


OcC 

oC 



h 

a 

< 

CQ 

ac 


Q 

s